Incidental Mutation 'R5936:Ppp1r1c'
ID501735
Institutional Source Beutler Lab
Gene Symbol Ppp1r1c
Ensembl Gene ENSMUSG00000034683
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 1C
Synonyms4930565M23Rik, 4930579P15Rik
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79707780-79818496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79756454 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 48 (E48V)
Ref Sequence ENSEMBL: ENSMUSP00000107410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040863] [ENSMUST00000090760] [ENSMUST00000111780]
Predicted Effect probably benign
Transcript: ENSMUST00000040863
SMART Domains Protein: ENSMUSP00000042784
Gene: ENSMUSG00000034683

DomainStartEndE-ValueType
Pfam:DARPP-32 1 75 2.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090760
AA Change: E48V

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088265
Gene: ENSMUSG00000034683
AA Change: E48V

DomainStartEndE-ValueType
Pfam:DARPP-32 2 108 1.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111780
AA Change: E48V

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107410
Gene: ENSMUSG00000034683
AA Change: E48V

DomainStartEndE-ValueType
Pfam:DARPP-32 1 86 7.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141978
Meta Mutation Damage Score 0.3029 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Ppp1r1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Ppp1r1c APN 2 79709897 critical splice acceptor site probably null
IGL03326:Ppp1r1c APN 2 79808383 missense probably benign 0.18
R4453:Ppp1r1c UTSW 2 79708231 missense possibly damaging 0.79
R6149:Ppp1r1c UTSW 2 79756466 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGCATCCACAATGGTGTCTAG -3'
(R):5'- CACTAATGTAGACTCATGCCAAAG -3'

Sequencing Primer
(F):5'- ATCCCCAGGTGAGTCAGTCTCTAG -3'
(R):5'- AGACTATGATGGGCTGAGCATTTAGC -3'
Posted On2017-12-01