Mutagenetix > Incidental Mutations

Incidental Mutation 'R6034:Mink1'

501776

Institutional Source

Beutler Lab

Gene Symbol

Mink1

Ensembl Gene

ENSMUSG00000020827

Gene Name

misshapen-like kinase 1 (zebrafish)

Synonyms

Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase

MMRRC Submission

044206-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6034 (G1)

Quality Score

123.467

Status

Not validated

Chromosome

Chromosomal Location

70562881-70614483 bp(+) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

AAGCAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAGCAG at 70607040 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]

Predicted Effect

probably benign
Transcript: ENSMUST00000072237

SMART Domains

Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	837	874	N/A	INTRINSIC
CNH	1026	1324	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072873

SMART Domains

Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	829	853	N/A	INTRINSIC
CNH	1019	1317	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079244

SMART Domains

Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	314	338	N/A	INTRINSIC
coiled coil region	348	493	N/A	INTRINSIC
low complexity region	554	566	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	643	656	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	826	850	N/A	INTRINSIC
CNH	1016	1314	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102558

SMART Domains

Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	792	816	N/A	INTRINSIC
CNH	982	1280	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102559

SMART Domains

Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	800	824	N/A	INTRINSIC
CNH	990	1288	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133310

Predicted Effect

probably benign
Transcript: ENSMUST00000136663

SMART Domains

Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	140	2.3e-22	PFAM
Pfam:Pkinase	1	143	1.6e-30	PFAM
low complexity region	161	192	N/A	INTRINSIC
coiled coil region	204	349	N/A	INTRINSIC
low complexity region	411	423	N/A	INTRINSIC
low complexity region	474	487	N/A	INTRINSIC
low complexity region	500	513	N/A	INTRINSIC
low complexity region	573	592	N/A	INTRINSIC
low complexity region	691	728	N/A	INTRINSIC
CNH	880	1178	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142650

Predicted Effect

probably benign
Transcript: ENSMUST00000149845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153503

Predicted Effect

probably benign
Transcript: ENSMUST00000178764

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 96.4%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef4	G	T	1: 34,721,903	G80V	unknown	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Atad2	A	T	15: 58,108,563	L306Q	probably damaging	Het
Atp2b4	T	A	1: 133,731,907		probably null	Het
Atp6v1c2	C	A	12: 17,307,500	G95V	possibly damaging	Het
Birc6	T	A	17: 74,615,283	V2192E	probably damaging	Het
Catsperb	A	G	12: 101,575,832	E597G	probably benign	Het
Ccdc129	T	A	6: 55,967,681	D462E	possibly damaging	Het
Ccdc40	A	G	11: 119,243,072	M556V	possibly damaging	Het
Ccin	G	A	4: 43,985,354	R587K	probably benign	Het
Cdipt	T	G	7: 126,978,325	V81G	probably damaging	Het
Cfh	T	C	1: 140,163,131	K40E	probably damaging	Het
Col4a3bp	A	C	13: 96,609,800	I236L	probably benign	Het
Cps1	T	A	1: 67,157,713		probably null	Het
Dnah7c	A	T	1: 46,457,258	D101V	probably benign	Het
Fastkd3	T	A	13: 68,583,610	W17R	probably damaging	Het
H2-Ob	T	C	17: 34,241,218	V30A	probably damaging	Het
Hist1h1e	A	G	13: 23,622,313	L62P	probably damaging	Het
Hmgxb3	T	A	18: 61,132,522	H1128L	probably damaging	Het
Hspbp1	A	T	7: 4,677,712	I255N	probably damaging	Het
Imp4	A	G	1: 34,443,456	D91G	probably damaging	Het
Kcnip4	G	T	5: 48,390,941	R241S	possibly damaging	Het
Lilra5	T	C	7: 4,242,134	L259P	probably benign	Het
Lipf	T	C	19: 33,964,889	I73T	probably benign	Het
Lsm7	T	C	10: 80,852,908		probably null	Het
Luzp2	T	A	7: 55,167,224	L141M	probably damaging	Het
Malrd1	T	A	2: 15,845,326	V1252E	possibly damaging	Het
Map10	T	C	8: 125,672,466	L866P	probably damaging	Het
Mpp2	T	C	11: 102,061,634	I355V	possibly damaging	Het
Mtrf1l	T	A	10: 5,823,834		probably benign	Het
Myo5c	A	T	9: 75,255,905	T339S	probably benign	Het
Naa15	A	G	3: 51,442,821	D163G	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1303	T	A	2: 111,814,357	Y123F	probably damaging	Het
Oosp2	A	G	19: 11,651,515	F74S	probably damaging	Het
Pard3	C	G	8: 127,064,327		probably benign	Het
Pcdha1	T	A	18: 36,930,598	I105N	probably damaging	Het
Pcdhgb8	A	G	18: 37,762,548	T224A	possibly damaging	Het
Phf12	A	G	11: 78,018,069	N325S	probably benign	Het
Prom1	T	A	5: 44,044,408		probably null	Het
Raet1e	A	G	10: 22,182,091	*252W	probably null	Het
Sap130	T	C	18: 31,689,406	V655A	possibly damaging	Het
Sec16b	A	T	1: 157,552,939	K360I	probably damaging	Het
Sec23ip	C	T	7: 128,750,203	T101I	possibly damaging	Het
Selenoo	A	G	15: 89,099,343	K529R	probably benign	Het
Slc22a15	A	G	3: 101,862,919	F451L	possibly damaging	Het
St6gal2	T	A	17: 55,482,981	S339T	probably benign	Het
Stard13	A	T	5: 151,095,500		probably null	Het
Synm	A	G	7: 67,734,905	V561A	probably damaging	Het
Tc2n	A	T	12: 101,651,201		probably null	Het
Ugt2b36	T	A	5: 87,081,518	D236V	probably damaging	Het
Vmn1r65	A	G	7: 6,008,869	L122P	probably damaging	Het
Zc3h14	T	C	12: 98,771,373	S40P	probably benign	Het
Zc3hav1l	C	A	6: 38,295,280	G185C	probably damaging	Het
Zfp563	G	A	17: 33,104,961	A177T	probably damaging	Het

Other mutations in Mink1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Mink1	APN	11	70603812	missense	probably damaging	0.99
IGL00709:Mink1	APN	11	70613019	missense	probably damaging	0.99
IGL01064:Mink1	APN	11	70603481	missense	probably benign	0.05
IGL02612:Mink1	APN	11	70597226	missense	probably damaging	1.00
IGL02797:Mink1	APN	11	70610350	missense	probably damaging	1.00
IGL03056:Mink1	APN	11	70612583	critical splice donor site	probably null
IGL03066:Mink1	APN	11	70608889	missense	probably benign	0.01
IGL03185:Mink1	APN	11	70603860	missense	probably damaging	1.00
PIT4498001:Mink1	UTSW	11	70598888	missense	probably benign	0.05
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0488:Mink1	UTSW	11	70597204	missense	probably damaging	1.00
R0637:Mink1	UTSW	11	70601676	missense	probably damaging	0.96
R0828:Mink1	UTSW	11	70610145	nonsense	probably null
R1081:Mink1	UTSW	11	70607035	missense	probably benign	0.07
R1175:Mink1	UTSW	11	70611340	missense	probably benign	0.02
R1441:Mink1	UTSW	11	70607114	missense	possibly damaging	0.72
R1532:Mink1	UTSW	11	70602007	missense	probably null	1.00
R1545:Mink1	UTSW	11	70598891	missense	possibly damaging	0.60
R1634:Mink1	UTSW	11	70608880	missense	probably benign	0.00
R1932:Mink1	UTSW	11	70608428	critical splice donor site	probably null
R2033:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R2184:Mink1	UTSW	11	70603797	missense	probably damaging	1.00
R2267:Mink1	UTSW	11	70601724	splice site	probably null
R2268:Mink1	UTSW	11	70601724	splice site	probably null
R2859:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R3713:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3714:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3715:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3716:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R3717:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R4607:Mink1	UTSW	11	70606067	missense	possibly damaging	0.72
R4735:Mink1	UTSW	11	70609260	splice site	probably null
R4790:Mink1	UTSW	11	70599041	missense	probably damaging	0.99
R4847:Mink1	UTSW	11	70602028	missense	probably damaging	1.00
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R5081:Mink1	UTSW	11	70605144	missense	probably damaging	0.98
R5310:Mink1	UTSW	11	70607343	missense	probably benign	0.33
R5677:Mink1	UTSW	11	70605165	missense	possibly damaging	0.66
R5767:Mink1	UTSW	11	70606075	missense	possibly damaging	0.53
R5795:Mink1	UTSW	11	70607790	missense	possibly damaging	0.86
R5888:Mink1	UTSW	11	70610059	unclassified	probably benign
R5950:Mink1	UTSW	11	70609586	missense	possibly damaging	0.81
R6024:Mink1	UTSW	11	70599089	missense	possibly damaging	0.71
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6058:Mink1	UTSW	11	70611720	missense	possibly damaging	0.96
R6144:Mink1	UTSW	11	70610652	missense	possibly damaging	0.66
R6154:Mink1	UTSW	11	70610101	missense	possibly damaging	0.46
R6218:Mink1	UTSW	11	70598894	missense	possibly damaging	0.94
R6262:Mink1	UTSW	11	70603325	splice site	probably null
R6269:Mink1	UTSW	11	70598987	missense	probably damaging	1.00
R6273:Mink1	UTSW	11	70611435	nonsense	probably null
R6301:Mink1	UTSW	11	70612294	missense	possibly damaging	0.71
R6603:Mink1	UTSW	11	70609593	missense	probably damaging	0.96
R6876:Mink1	UTSW	11	70607435	missense	probably benign	0.02
R7030:Mink1	UTSW	11	70607775	missense	possibly damaging	0.46
R7050:Mink1	UTSW	11	70612332	missense	possibly damaging	0.93
R7094:Mink1	UTSW	11	70610075	splice site	probably null
R7135:Mink1	UTSW	11	70603503	missense	probably damaging	1.00
R7238:Mink1	UTSW	11	70611479	critical splice donor site	probably null
R7320:Mink1	UTSW	11	70599073	missense	probably benign	0.23
R7396:Mink1	UTSW	11	70605168	missense	possibly damaging	0.73
R7446:Mink1	UTSW	11	70609629	missense	probably benign	0.18

Predicted Primers

Posted On

2017-12-01