Mutagenetix > Incidental Mutation

Incidental Mutation 'R6036:Ugt3a1'

501777

Institutional Source

Beutler Lab

Gene Symbol

Ugt3a1

Ensembl Gene

ENSMUSG00000072664

Gene Name

UDP glycosyltransferases 3 family, polypeptide A1

Synonyms

MMRRC Submission

043257-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R6036 (G1)

Quality Score

137.008

Status

Not validated

Chromosome

Chromosomal Location

9276888-9315032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9306086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 107 (H107L)

Ref Sequence

ENSEMBL: ENSMUSP00000022861 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022861]

AlphaFold

Q3UP75

Predicted Effect

probably benign
Transcript: ENSMUST00000022861
AA Change: H107L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: H107L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:UDPGT	23	521	1.4e-98	PFAM
Pfam:Glyco_tran_28_C	300	451	3.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175695

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176173

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3	T	C	11: 95,832,858		probably benign	Het
Ago1	C	T	4: 126,443,228	R228H	probably damaging	Het
Alpk3	G	A	7: 81,093,257	V941M	probably benign	Het
Ano4	A	G	10: 88,982,265	W588R	possibly damaging	Het
Atp6v1a	A	G	16: 44,098,831	Y464H	probably benign	Het
Barx2	A	T	9: 31,913,008	D28E	probably damaging	Het
Cabp5	A	T	7: 13,401,335	M67L	probably damaging	Het
Col10a1	A	G	10: 34,395,282	T417A	probably benign	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Eif4enif1	T	C	11: 3,239,420	S227P	probably damaging	Het
Erv3	G	A	2: 131,856,005	H145Y	possibly damaging	Het
Exoc5	T	C	14: 49,014,322	T591A	possibly damaging	Het
F5	A	T	1: 164,184,996	E493V	probably damaging	Het
Gm8444	G	T	15: 81,843,593		probably benign	Het
Gria4	T	A	9: 4,537,646	I221L	probably benign	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hc	T	C	2: 35,039,684	T249A	probably benign	Het
Herc2	A	G	7: 56,068,053	T48A	probably benign	Het
Hist1h2bl	A	T	13: 21,715,978	S56T	probably damaging	Het
Hp	A	G	8: 109,576,774		probably null	Het
Ifna15	T	G	4: 88,558,073	D58A	possibly damaging	Het
Kcnj1	A	T	9: 32,397,125	M262L	probably benign	Het
Krt83	A	C	15: 101,487,531	I320S	possibly damaging	Het
Megf10	A	G	18: 57,242,727	N242D	probably damaging	Het
Nup155	A	G	15: 8,128,411	T451A	probably benign	Het
Olfr1277	C	T	2: 111,269,612	G252R	probably damaging	Het
Olfr1288	T	C	2: 111,478,988	L68P	probably damaging	Het
Olfr559	T	A	7: 102,724,485	I2F	probably benign	Het
Olfr701	A	T	7: 106,818,460	I126F	probably damaging	Het
Olfr930	A	G	9: 38,930,920	I250V	probably damaging	Het
Pdzd8	G	A	19: 59,305,209	P403S	probably damaging	Het
Piezo2	G	A	18: 63,114,948	Q494*	probably null	Het
Pik3c2b	T	C	1: 133,090,713	F966S	possibly damaging	Het
Plag1	T	C	4: 3,904,618	E191G	possibly damaging	Het
Pou4f2	A	T	8: 78,435,474	S167T	probably damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scd4	G	A	19: 44,344,792	D319N	probably damaging	Het
Senp2	A	T	16: 22,028,558	R279*	probably null	Het
Sh3rf3	G	A	10: 58,813,984	G137D	probably benign	Het
Simc1	C	T	13: 54,524,621	P261S	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc26a1	T	A	5: 108,673,570	D151V	probably damaging	Het
Snx29	A	G	16: 11,738,437		probably null	Het
Stard9	C	T	2: 120,700,075	A2271V	probably benign	Het
Stat6	A	G	10: 127,655,444	N485D	possibly damaging	Het
Tpcn2	T	C	7: 145,268,869	T280A	possibly damaging	Het
Ttc23	A	G	7: 67,711,366	I378V	possibly damaging	Het
Ttc29	A	G	8: 78,325,576	D362G	probably benign	Het
Ttll7	A	G	3: 146,940,162	I592V	probably benign	Het
Vmn1r70	A	G	7: 10,633,903	Q87R	probably damaging	Het
Vmn2r-ps129	T	C	17: 22,995,172		noncoding transcript	Het
Wdfy4	G	T	14: 33,146,990	S360R	probably damaging	Het
Zfp780b	A	G	7: 27,963,568	Y521H	probably damaging	Het

Other mutations in Ugt3a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00912:Ugt3a1	APN	15	9310612	missense	probably damaging	1.00
IGL01752:Ugt3a1	APN	15	9306146	missense	probably damaging	1.00
IGL02438:Ugt3a1	APN	15	9291976	missense	possibly damaging	0.90
PIT4354001:Ugt3a1	UTSW	15	9306360	nonsense	probably null
R0127:Ugt3a1	UTSW	15	9306256	missense	probably benign	0.01
R0647:Ugt3a1	UTSW	15	9310549	missense	probably benign	0.00
R0841:Ugt3a1	UTSW	15	9306128	missense	probably benign	0.07
R1395:Ugt3a1	UTSW	15	9306292	missense	possibly damaging	0.92
R1616:Ugt3a1	UTSW	15	9306244	nonsense	probably null
R2338:Ugt3a1	UTSW	15	9291973	splice site	probably benign
R3797:Ugt3a1	UTSW	15	9310641	nonsense	probably null
R4305:Ugt3a1	UTSW	15	9306274	missense	possibly damaging	0.92
R4385:Ugt3a1	UTSW	15	9306479	missense	probably benign	0.15
R4572:Ugt3a1	UTSW	15	9306393	missense	probably benign	0.00
R4611:Ugt3a1	UTSW	15	9306400	nonsense	probably null
R4744:Ugt3a1	UTSW	15	9310553	missense	probably benign	0.36
R5715:Ugt3a1	UTSW	15	9306344	missense	probably damaging	0.96
R6036:Ugt3a1	UTSW	15	9306086	missense	probably benign	0.01
R6156:Ugt3a1	UTSW	15	9310676	missense	possibly damaging	0.83
R6228:Ugt3a1	UTSW	15	9310640	missense	possibly damaging	0.81
R6344:Ugt3a1	UTSW	15	9306231	missense	probably damaging	0.98
R6380:Ugt3a1	UTSW	15	9306455	missense	probably benign	0.00
R6383:Ugt3a1	UTSW	15	9306455	missense	probably benign	0.00
R6737:Ugt3a1	UTSW	15	9311809	missense	probably benign	0.30
R6848:Ugt3a1	UTSW	15	9280052	splice site	probably null
R6937:Ugt3a1	UTSW	15	9292072	missense	probably benign	0.00
R7061:Ugt3a1	UTSW	15	9306154	missense	probably benign	0.12
R7672:Ugt3a1	UTSW	15	9310693	nonsense	probably null
R7840:Ugt3a1	UTSW	15	9311817	missense	probably damaging	1.00
R7945:Ugt3a1	UTSW	15	9284175	critical splice donor site	probably null
R8105:Ugt3a1	UTSW	15	9306390	missense	probably benign	0.00
R8414:Ugt3a1	UTSW	15	9310583	missense	possibly damaging	0.82
R8981:Ugt3a1	UTSW	15	9311928	missense	probably benign	0.20
R9111:Ugt3a1	UTSW	15	9306247	missense	possibly damaging	0.69
R9451:Ugt3a1	UTSW	15	9292072	missense	probably benign	0.00
R9567:Ugt3a1	UTSW	15	9306284	missense	possibly damaging	0.82
R9657:Ugt3a1	UTSW	15	9280047	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTACAGAGCCTCTTTCCTTAAAA -3'
(R):5'- GACACAAATCGTTTCCCAAGCT -3'

Sequencing Primer
(F):5'- GTACTGCTGGCCTCAAAGTCAC -3'
(R):5'- GTTTCCCAAGCTTTTCAACAATCAGG -3'

Posted On

2017-12-01