Incidental Mutation 'R4212:Phf2'
ID501790
Institutional Source Beutler Lab
Gene Symbol Phf2
Ensembl Gene ENSMUSG00000038025
Gene NamePHD finger protein 2
Synonyms
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location48801750-48871119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48820613 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 318 (G318V)
Ref Sequence ENSEMBL: ENSMUSP00000047308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035540]
Predicted Effect unknown
Transcript: ENSMUST00000035540
AA Change: G318V
SMART Domains Protein: ENSMUSP00000047308
Gene: ENSMUSG00000038025
AA Change: G318V

DomainStartEndE-ValueType
PHD 7 54 1.08e-9 SMART
JmjC 197 353 1.98e-47 SMART
low complexity region 468 481 N/A INTRINSIC
low complexity region 487 532 N/A INTRINSIC
low complexity region 884 891 N/A INTRINSIC
coiled coil region 924 948 N/A INTRINSIC
low complexity region 953 1021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body weight, decreased adipocity and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Phf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Phf2 APN 13 48819607 missense unknown
IGL01554:Phf2 APN 13 48805879 nonsense probably null
IGL02063:Phf2 APN 13 48821642 missense unknown
IGL02456:Phf2 APN 13 48828846 missense unknown
IGL02498:Phf2 APN 13 48805239 missense unknown
IGL02586:Phf2 APN 13 48813858 splice site probably benign
IGL02688:Phf2 APN 13 48805839 missense unknown
H8441:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
R0265:Phf2 UTSW 13 48828794 missense unknown
R0389:Phf2 UTSW 13 48804489 missense unknown
R0535:Phf2 UTSW 13 48813947 missense unknown
R1162:Phf2 UTSW 13 48819641 splice site probably benign
R1342:Phf2 UTSW 13 48804477 missense unknown
R1551:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R1551:Phf2 UTSW 13 48832103 missense unknown
R1567:Phf2 UTSW 13 48832113 missense unknown
R1698:Phf2 UTSW 13 48807630 missense unknown
R1766:Phf2 UTSW 13 48819557 missense unknown
R1785:Phf2 UTSW 13 48817567 missense unknown
R1997:Phf2 UTSW 13 48828908 missense unknown
R2034:Phf2 UTSW 13 48817730 missense unknown
R2096:Phf2 UTSW 13 48832113 nonsense probably null
R2147:Phf2 UTSW 13 48804689 missense unknown
R2149:Phf2 UTSW 13 48804689 missense unknown
R2154:Phf2 UTSW 13 48820073 missense unknown
R2296:Phf2 UTSW 13 48835278 missense unknown
R4749:Phf2 UTSW 13 48821709 intron probably null
R4770:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R4948:Phf2 UTSW 13 48807722 missense unknown
R4989:Phf2 UTSW 13 48807844 missense unknown
R5792:Phf2 UTSW 13 48820042 splice site probably null
R5848:Phf2 UTSW 13 48820070 missense unknown
R6092:Phf2 UTSW 13 48816057 missense unknown
R6165:Phf2 UTSW 13 48813865 critical splice donor site probably null
R6192:Phf2 UTSW 13 48820107 missense unknown
R6237:Phf2 UTSW 13 48803655 nonsense probably null
R6249:Phf2 UTSW 13 48805872 missense unknown
R6489:Phf2 UTSW 13 48826182 missense unknown
R7616:Phf2 UTSW 13 48807607 missense unknown
R8058:Phf2 UTSW 13 48823082 missense unknown
V1024:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
X0027:Phf2 UTSW 13 48832118 missense unknown
Z1176:Phf2 UTSW 13 48807707 missense unknown
Z1177:Phf2 UTSW 13 48804593 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATGGAACCTACCCCTCTTC -3'
(R):5'- GGTACTCGAGTGTTCAATAGCC -3'

Sequencing Primer
(F):5'- GATGTCAGCATAGCAACCCATAGG -3'
(R):5'- CGAGTGTTCAATAGCCTATGTGACC -3'
Posted On2017-12-01