Incidental Mutation 'R4176:Fam149a'
ID501792
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Namefamily with sequence similarity 149, member A
Synonyms
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45336717-45382291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45341284 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 614 (Y614H)
Ref Sequence ENSEMBL: ENSMUSP00000114612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526] [ENSMUST00000155230]
Predicted Effect probably benign
Transcript: ENSMUST00000093526
AA Change: Y695H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: Y695H

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135912
AA Change: Y651H
SMART Domains Protein: ENSMUSP00000120196
Gene: ENSMUSG00000070044
AA Change: Y651H

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 90 108 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
Pfam:DUF3719 259 324 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155230
AA Change: Y614H

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114612
Gene: ENSMUSG00000070044
AA Change: Y614H

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 55 73 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
Pfam:DUF3719 224 291 5.8e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45339343 missense probably damaging 1.00
IGL00229:Fam149a APN 8 45351786 missense probably damaging 0.98
IGL01089:Fam149a APN 8 45348527 missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45350442 missense probably damaging 1.00
IGL03095:Fam149a APN 8 45341228 missense probably damaging 1.00
IGL03112:Fam149a APN 8 45348543 missense possibly damaging 0.78
guangxi UTSW 8 45381741 missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45351706 missense probably benign 0.00
R0111:Fam149a UTSW 8 45341146 splice site probably benign
R0113:Fam149a UTSW 8 45341024 missense probably damaging 1.00
R0452:Fam149a UTSW 8 45355649 missense probably damaging 1.00
R0604:Fam149a UTSW 8 45345008 missense probably damaging 1.00
R1441:Fam149a UTSW 8 45355647 missense probably damaging 1.00
R1672:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45339362 nonsense probably null
R1981:Fam149a UTSW 8 45381741 missense probably damaging 1.00
R2173:Fam149a UTSW 8 45353954 missense probably damaging 1.00
R2211:Fam149a UTSW 8 45341009 missense probably damaging 0.99
R3807:Fam149a UTSW 8 45381610 missense possibly damaging 0.91
R4913:Fam149a UTSW 8 45353883 missense probably damaging 1.00
R5158:Fam149a UTSW 8 45350435 missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45344653 missense probably damaging 0.99
R5436:Fam149a UTSW 8 45348471 missense probably benign 0.21
R6060:Fam149a UTSW 8 45358762 intron probably benign
R6426:Fam149a UTSW 8 45381574 missense probably benign
R6590:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6596:Fam149a UTSW 8 45381630 missense probably benign 0.25
R6690:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6730:Fam149a UTSW 8 45381174 missense probably damaging 1.00
R6734:Fam149a UTSW 8 45381441 missense probably benign
R6916:Fam149a UTSW 8 45350406 missense probably damaging 1.00
R7088:Fam149a UTSW 8 45350545 missense probably benign 0.08
R7219:Fam149a UTSW 8 45350563 missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45340997 missense probably damaging 0.98
R7454:Fam149a UTSW 8 45348546 missense probably benign 0.29
R7591:Fam149a UTSW 8 45350435 missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45381517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCTGACTGTCAGGAGAAAG -3'
(R):5'- ACAGACTCAGGTTTAGATGTTTCC -3'

Sequencing Primer
(F):5'- CAGAGGGATGAATTGTATCGTTTTC -3'
(R):5'- GACTCAGGTTTAGATGTTTCCATAGC -3'
Posted On2017-12-01