Incidental Mutation 'R4482:Pomt2'
ID501797
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87131830 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 290 (P290S)
Ref Sequence ENSEMBL: ENSMUSP00000035260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably benign
Transcript: ENSMUST00000037788
AA Change: P290S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126
AA Change: P290S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222147
Predicted Effect probably benign
Transcript: ENSMUST00000222634
AA Change: P220S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
PIT4366001:Pomt2 UTSW 12 87116529 critical splice donor site probably null
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R5790:Pomt2 UTSW 12 87127378 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6370:Pomt2 UTSW 12 87109199 missense probably damaging 1.00
R6631:Pomt2 UTSW 12 87139643 critical splice donor site probably null
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
R7690:Pomt2 UTSW 12 87130367 missense probably damaging 1.00
R7864:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R7947:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R8060:Pomt2 UTSW 12 87129006 missense not run
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Z1177:Pomt2 UTSW 12 87111442 missense not run
Z1177:Pomt2 UTSW 12 87139681 missense not run
Predicted Primers PCR Primer
(F):5'- AATGGTAAGCAGCACTGTGG -3'
(R):5'- CTCTCACAGTGACTTGCCTG -3'

Sequencing Primer
(F):5'- GACATTTCCACAAGCGCTTGAG -3'
(R):5'- CTCACAGTGACTTGCCTGTAGTTTG -3'
Posted On2017-12-01