Incidental Mutation 'R4500:Sugp1'
ID501802
Institutional Source Beutler Lab
Gene Symbol Sugp1
Ensembl Gene ENSMUSG00000011306
Gene NameSURP and G patch domain containing 1
SynonymsSf4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4500 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70042813-70072347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70056388 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000011450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011450]
PDB Structure
Solution structure of SURP domain in BAB30904 [SOLUTION NMR]
Solution structure of SURP domain in splicing factor 4 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000011450
AA Change: S104P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011450
Gene: ENSMUSG00000011306
AA Change: S104P

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
SWAP 185 239 8e-20 SMART
SWAP 260 314 4.09e-17 SMART
low complexity region 344 365 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
G_patch 558 605 3.25e-17 SMART
low complexity region 628 643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SF4 is a member of the SURP family of splicing factors.[supplied by OMIM, Sep 2003]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,541 C214* probably null Het
4931409K22Rik T C 5: 24,548,277 D459G possibly damaging Het
Ap3s1 T C 18: 46,790,000 V186A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Fam83d A G 2: 158,785,267 E292G probably benign Het
Gm4981 C T 10: 58,235,706 A229T possibly damaging Het
Hook1 T C 4: 95,993,200 probably null Het
Klhl18 C T 9: 110,429,966 G445S probably damaging Het
Olfr298 A T 7: 86,488,919 C211S probably benign Het
Olfr644 A G 7: 104,068,195 S279P probably damaging Het
Pias3 C T 3: 96,701,418 R259W probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Tmem239 A G 2: 130,407,157 Y145C possibly damaging Het
Uchl4 T C 9: 64,235,881 F215L possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Usp7 C T 16: 8,695,895 E785K possibly damaging Het
Vmn2r66 G A 7: 85,007,954 A81V probably damaging Het
Other mutations in Sugp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Sugp1 APN 8 70043084 unclassified probably benign
IGL02532:Sugp1 APN 8 70059819 missense possibly damaging 0.91
IGL02887:Sugp1 APN 8 70070126 missense probably damaging 1.00
IGL02962:Sugp1 APN 8 70059862 splice site probably benign
IGL02966:Sugp1 APN 8 70071108 unclassified probably benign
IGL03383:Sugp1 APN 8 70069567 unclassified probably benign
R0348:Sugp1 UTSW 8 70070008 missense probably damaging 1.00
R0376:Sugp1 UTSW 8 70052638 missense probably damaging 1.00
R0511:Sugp1 UTSW 8 70059363 missense probably damaging 1.00
R1930:Sugp1 UTSW 8 70071540 missense probably benign 0.05
R1931:Sugp1 UTSW 8 70071540 missense probably benign 0.05
R1933:Sugp1 UTSW 8 70056575 missense possibly damaging 0.92
R1934:Sugp1 UTSW 8 70056575 missense possibly damaging 0.92
R2391:Sugp1 UTSW 8 70059411 splice site probably null
R2484:Sugp1 UTSW 8 70069524 missense possibly damaging 0.89
R4876:Sugp1 UTSW 8 70071184 missense probably damaging 0.99
R5120:Sugp1 UTSW 8 70048667 missense probably benign 0.02
R5724:Sugp1 UTSW 8 70070149 missense probably damaging 0.98
R6736:Sugp1 UTSW 8 70059303 missense probably benign 0.44
R6967:Sugp1 UTSW 8 70060552 missense possibly damaging 0.79
R7107:Sugp1 UTSW 8 70070150 missense probably benign 0.00
R7388:Sugp1 UTSW 8 70052619 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCCAAGCCCTGACTTATC -3'
(R):5'- ATGTGAGCTACTGACCCAGC -3'

Sequencing Primer
(F):5'- CTTCTTTCAGCTAGGAACTCGAAG -3'
(R):5'- TCCTCATCATCATCAGGGGAC -3'
Posted On2017-12-01