Incidental Mutation 'R4504:4930503E14Rik'
ID501806
Institutional Source Beutler Lab
Gene Symbol 4930503E14Rik
Ensembl Gene ENSMUSG00000072595
Gene NameRIKEN cDNA 4930503E14 gene
Synonyms
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4504 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location44163169-44213254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44170442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 45 (S45P)
Ref Sequence ENSEMBL: ENSMUSP00000098254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100688] [ENSMUST00000226164]
Predicted Effect probably damaging
Transcript: ENSMUST00000100688
AA Change: S45P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098254
Gene: ENSMUSG00000072595
AA Change: S45P

DomainStartEndE-ValueType
Pfam:Takusan 48 128 3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226164
AA Change: S69P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226475
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in 4930503E14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:4930503E14Rik APN 14 44163934 missense probably benign 0.10
IGL01995:4930503E14Rik APN 14 44163845 utr 3 prime probably benign
R2925:4930503E14Rik UTSW 14 44170298 missense probably damaging 0.98
R4067:4930503E14Rik UTSW 14 44169184 missense probably damaging 0.99
R4347:4930503E14Rik UTSW 14 44171178 missense probably damaging 0.96
R4414:4930503E14Rik UTSW 14 44169233 missense probably benign 0.00
R5047:4930503E14Rik UTSW 14 44169241 missense possibly damaging 0.87
R7489:4930503E14Rik UTSW 14 44170299 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTCAACAGGATACAGGGC -3'
(R):5'- ATTTCAGGGTAAGTGGGAATGC -3'

Sequencing Primer
(F):5'- CAGGATACAGGGCATAATTTTACCTG -3'
(R):5'- TTCAGGGTAAGTGGGAATGCTATAAG -3'
Posted On2017-12-01