Incidental Mutation 'R6182:Mon2'
ID501809
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene NameMON2 homolog, regulator of endosome to Golgi trafficking
Synonyms2610528O22Rik, SF21
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location122992060-123076505 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 123038659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000170935] [ENSMUST00000170935] [ENSMUST00000219203] [ENSMUST00000219203]
Predicted Effect probably null
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219203
Predicted Effect probably null
Transcript: ENSMUST00000219203
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Ctsl T C 13: 64,367,972 Y95C probably damaging Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gpc2 T C 5: 138,278,414 D150G probably benign Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Olfr173 A G 16: 58,797,292 Y185H probably damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pkd1l1 T C 11: 8,865,555 E1452G probably benign Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Slc39a6 G T 18: 24,600,956 N225K probably benign Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 123026299 missense probably damaging 1.00
IGL01072:Mon2 APN 10 123010539 nonsense probably null
IGL02080:Mon2 APN 10 123052190 missense probably damaging 0.98
IGL02157:Mon2 APN 10 123013472 missense probably damaging 1.00
IGL02419:Mon2 APN 10 123016447 missense probably benign 0.05
IGL02498:Mon2 APN 10 123034330 missense probably benign 0.00
IGL02638:Mon2 APN 10 123023939 missense probably damaging 1.00
IGL02664:Mon2 APN 10 123009496 splice site probably benign
IGL02690:Mon2 APN 10 123009627 missense possibly damaging 0.67
IGL02878:Mon2 APN 10 123006991 missense probably benign 0.09
IGL03092:Mon2 APN 10 123018100 missense probably damaging 1.00
IGL03103:Mon2 APN 10 123030103 splice site probably benign
IGL03208:Mon2 APN 10 123018069 splice site probably benign
R0010:Mon2 UTSW 10 123032694 missense probably damaging 1.00
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0145:Mon2 UTSW 10 123013512 missense possibly damaging 0.94
R0390:Mon2 UTSW 10 123007021 missense probably null 0.05
R0481:Mon2 UTSW 10 123013396 missense possibly damaging 0.94
R0513:Mon2 UTSW 10 123038610 missense probably damaging 1.00
R0599:Mon2 UTSW 10 123026065 splice site probably benign
R1226:Mon2 UTSW 10 123002819 missense probably benign 0.17
R1548:Mon2 UTSW 10 123036007 splice site probably benign
R1598:Mon2 UTSW 10 123016396 missense probably damaging 1.00
R1650:Mon2 UTSW 10 122995777 missense probably benign 0.45
R1687:Mon2 UTSW 10 123026124 missense probably damaging 0.98
R1721:Mon2 UTSW 10 123031097 missense probably damaging 0.98
R1768:Mon2 UTSW 10 123013763 missense probably benign 0.00
R1827:Mon2 UTSW 10 123046311 missense probably damaging 0.97
R1879:Mon2 UTSW 10 123002885 missense probably damaging 1.00
R1954:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1955:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1968:Mon2 UTSW 10 123009565 missense probably damaging 1.00
R2060:Mon2 UTSW 10 122995776 missense probably damaging 1.00
R2160:Mon2 UTSW 10 123075929 nonsense probably null
R2165:Mon2 UTSW 10 123042364 splice site probably null
R3737:Mon2 UTSW 10 123013375 missense probably damaging 1.00
R3814:Mon2 UTSW 10 123013565 missense probably damaging 0.98
R4058:Mon2 UTSW 10 123002819 missense probably benign 0.17
R4091:Mon2 UTSW 10 123038510 missense probably damaging 1.00
R4214:Mon2 UTSW 10 123016492 missense probably benign 0.03
R4354:Mon2 UTSW 10 123026983 missense probably benign 0.02
R4422:Mon2 UTSW 10 123042982 missense probably damaging 1.00
R4505:Mon2 UTSW 10 123009589 missense probably damaging 0.99
R4791:Mon2 UTSW 10 123006057 missense probably benign 0.01
R4797:Mon2 UTSW 10 123016517 missense probably benign 0.45
R4944:Mon2 UTSW 10 123038459 critical splice donor site probably null
R4982:Mon2 UTSW 10 122995789 missense probably damaging 1.00
R5298:Mon2 UTSW 10 123010606 missense probably benign
R5503:Mon2 UTSW 10 123032645 missense possibly damaging 0.54
R5653:Mon2 UTSW 10 123026094 missense probably damaging 0.96
R5687:Mon2 UTSW 10 123008239 missense probably damaging 0.99
R5838:Mon2 UTSW 10 123010492 critical splice donor site probably null
R6108:Mon2 UTSW 10 123032695 missense probably benign 0.00
R6355:Mon2 UTSW 10 123022920 missense possibly damaging 0.58
R6358:Mon2 UTSW 10 123013504 missense probably damaging 0.98
R6548:Mon2 UTSW 10 123036093 missense probably damaging 1.00
R6557:Mon2 UTSW 10 123016402 missense probably damaging 1.00
R6649:Mon2 UTSW 10 123038480 missense possibly damaging 0.46
R7140:Mon2 UTSW 10 123035453 missense probably benign 0.00
R7303:Mon2 UTSW 10 123038459 critical splice donor site probably null
R7317:Mon2 UTSW 10 123013946 missense probably damaging 0.97
R7355:Mon2 UTSW 10 123009516 missense probably benign
R7508:Mon2 UTSW 10 123023939 missense probably damaging 1.00
R7509:Mon2 UTSW 10 123032552 missense probably benign
R7647:Mon2 UTSW 10 123006026 missense probably benign
R7720:Mon2 UTSW 10 123032588 missense probably benign 0.00
X0022:Mon2 UTSW 10 123006102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAAATGAACACTTACCAAGAGGCT -3'
(R):5'- GCTTAATCTGCATTTAATGGTGAACTT -3'

Sequencing Primer
(F):5'- CCAAGAGGCTGTAAAACTGCTTGATC -3'
(R):5'- CATTCAGATTTCAGGTGATCAGC -3'
Posted On2017-12-04