Incidental Mutation 'R6130:Ccdc39'
ID501810
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Namecoiled-coil domain containing 39
Synonymsb2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location33812362-33844310 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 33841192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222]
Predicted Effect probably null
Transcript: ENSMUST00000029222
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33815485 missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33836733 missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 synonymous probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33814471 missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33830105 missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33832676 missense possibly damaging 0.55
R7695:Ccdc39 UTSW 3 33814519 missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33832617 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGTGGCACGTAATACCCAATG -3'
(R):5'- GCTCTCATAAATGAATCAGTGCC -3'

Sequencing Primer
(F):5'- GTGGCACGTAATACCCAATGACAAC -3'
(R):5'- TGAATCAGTGCCCGTATAAAAAG -3'
Posted On2017-12-04