Incidental Mutation 'R6128:Bicc1'
ID 501823
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene Name BicC family RNA binding protein 1
Synonyms Bic-C, jcpk
MMRRC Submission 044275-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 70758662-70995530 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 70776313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
AlphaFold Q99MQ1
Predicted Effect probably null
Transcript: ENSMUST00000014473
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131445
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143791
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
A430033K04Rik A G 5: 138,646,038 (GRCm39) H641R probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Asah1 C T 8: 41,807,092 (GRCm39) V111M probably damaging Het
Ascc3 T C 10: 50,526,734 (GRCm39) L611P probably damaging Het
Atl2 C A 17: 80,172,470 (GRCm39) probably null Het
Bhlhe22 A T 3: 18,109,987 (GRCm39) S346C probably damaging Het
Bptf G T 11: 106,965,516 (GRCm39) A1163D possibly damaging Het
Bub1b T A 2: 118,448,293 (GRCm39) C382S probably benign Het
Carmil1 A T 13: 24,197,177 (GRCm39) Y158* probably null Het
Ccdc175 A T 12: 72,175,933 (GRCm39) I473K probably benign Het
Ccdc18 A G 5: 108,311,625 (GRCm39) I444V possibly damaging Het
Cep131 T A 11: 119,956,801 (GRCm39) I880F probably damaging Het
Ces2e T A 8: 105,655,428 (GRCm39) I117N probably benign Het
Clk2 C T 3: 89,081,531 (GRCm39) T289M probably damaging Het
Crocc2 A T 1: 93,122,123 (GRCm39) D672V probably benign Het
Cul7 T A 17: 46,962,588 (GRCm39) I73N probably damaging Het
Cyp2d12 C A 15: 82,443,166 (GRCm39) D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 (GRCm39) S142P possibly damaging Het
Daw1 T A 1: 83,183,647 (GRCm39) C232* probably null Het
Dhx9 T C 1: 153,353,835 (GRCm39) K195R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpp3 A G 19: 4,972,420 (GRCm39) V168A probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ercc6l2 T C 13: 64,001,563 (GRCm39) V459A probably damaging Het
Erp44 A T 4: 48,243,493 (GRCm39) N38K probably damaging Het
Fam135a A G 1: 24,069,821 (GRCm39) probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fdps T C 3: 89,006,740 (GRCm39) E117G possibly damaging Het
Gbp4 A C 5: 105,283,030 (GRCm39) V80G possibly damaging Het
Glt1d1 A T 5: 127,754,335 (GRCm39) D179V probably damaging Het
Gtf2a1l T A 17: 89,002,086 (GRCm39) V314E probably null Het
Gzmf G T 14: 56,443,443 (GRCm39) Y178* probably null Het
Hira C T 16: 18,751,727 (GRCm39) P509S probably benign Het
Ifi44 T C 3: 151,454,823 (GRCm39) N134S probably benign Het
Igfbp2 T A 1: 72,863,958 (GRCm39) C74S probably damaging Het
Il24 A G 1: 130,813,435 (GRCm39) L54P probably damaging Het
Ints10 T C 8: 69,274,904 (GRCm39) probably null Het
Ipo9 A G 1: 135,318,311 (GRCm39) C700R possibly damaging Het
Kalrn T A 16: 34,033,255 (GRCm39) Q469L probably damaging Het
Lrp1b T G 2: 40,750,667 (GRCm39) I2966L probably benign Het
Lta C A 17: 35,422,817 (GRCm39) V169L possibly damaging Het
Lyst T C 13: 13,933,964 (GRCm39) V3554A possibly damaging Het
Mobp A G 9: 119,997,392 (GRCm39) probably benign Het
Myorg T A 4: 41,498,445 (GRCm39) N395I probably damaging Het
Or10d1 C G 9: 39,484,549 (GRCm39) R2T probably benign Het
Or4b1d A T 2: 89,968,954 (GRCm39) C176* probably null Het
Or8c14-ps1 T C 9: 38,101,299 (GRCm39) S93P probably benign Het
Pacs1 A T 19: 5,202,400 (GRCm39) probably null Het
Phf21a G T 2: 92,181,953 (GRCm39) probably null Het
Pick1 T A 15: 79,123,896 (GRCm39) M89K probably damaging Het
Pik3cb T C 9: 98,946,152 (GRCm39) D558G possibly damaging Het
Pnma8a A G 7: 16,694,661 (GRCm39) D172G probably benign Het
Polr2a A C 11: 69,627,803 (GRCm39) V1368G probably damaging Het
Pomt2 A G 12: 87,158,109 (GRCm39) probably null Het
Pou2f1 T C 1: 165,703,056 (GRCm39) probably benign Het
Rnf145 T C 11: 44,446,018 (GRCm39) V284A probably damaging Het
Robo1 A T 16: 72,809,956 (GRCm39) M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr3 C T 2: 112,784,639 (GRCm39) probably null Het
Scamp1 A C 13: 94,344,735 (GRCm39) L202R possibly damaging Het
Snx25 C T 8: 46,558,240 (GRCm39) V110I probably benign Het
Spata31e2 G A 1: 26,724,506 (GRCm39) P225S probably benign Het
Susd6 T A 12: 80,915,388 (GRCm39) H124Q possibly damaging Het
Tarm1 T C 7: 3,537,720 (GRCm39) T248A probably benign Het
Tc2n A G 12: 101,675,748 (GRCm39) M1T probably null Het
Tcerg1 C A 18: 42,644,563 (GRCm39) probably null Het
Ticrr C A 7: 79,343,716 (GRCm39) P1194T probably damaging Het
Trim31 T G 17: 37,220,491 (GRCm39) V469G probably benign Het
Vcp T C 4: 42,980,941 (GRCm39) E723G probably benign Het
Vmn1r177 C A 7: 23,565,267 (GRCm39) S203I probably damaging Het
Vmn1r177 T A 7: 23,565,268 (GRCm39) S203C probably damaging Het
Vmn1r210 A T 13: 23,012,277 (GRCm39) L3* probably null Het
Wdr27 T A 17: 15,152,796 (GRCm39) R104* probably null Het
Wnk1 A C 6: 119,940,747 (GRCm39) probably null Het
Zfp157 A G 5: 138,453,281 (GRCm39) E88G possibly damaging Het
Zfp708 A T 13: 67,222,965 (GRCm39) L22Q probably damaging Het
Zfp788 T C 7: 41,299,785 (GRCm39) F787S probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70,796,987 (GRCm39) missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70,792,006 (GRCm39) missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70,779,190 (GRCm39) splice site probably benign
IGL02829:Bicc1 APN 10 70,794,710 (GRCm39) missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70,789,268 (GRCm39) missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70,782,432 (GRCm39) missense probably benign 0.00
artemis UTSW 10 70,863,784 (GRCm39) missense probably damaging 0.99
Pebbles UTSW 10 70,783,730 (GRCm39) missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70,793,511 (GRCm39) missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70,796,988 (GRCm39) missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70,761,200 (GRCm39) missense probably damaging 1.00
R0184:Bicc1 UTSW 10 70,915,045 (GRCm39) missense probably benign
R0469:Bicc1 UTSW 10 70,915,045 (GRCm39) missense probably benign
R0485:Bicc1 UTSW 10 70,761,145 (GRCm39) missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70,793,020 (GRCm39) missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70,794,677 (GRCm39) missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70,779,348 (GRCm39) missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70,794,614 (GRCm39) missense probably damaging 1.00
R1943:Bicc1 UTSW 10 70,995,353 (GRCm39) missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70,785,955 (GRCm39) missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70,782,633 (GRCm39) critical splice donor site probably null
R2519:Bicc1 UTSW 10 70,766,474 (GRCm39) missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70,779,204 (GRCm39) frame shift probably null
R4363:Bicc1 UTSW 10 70,779,204 (GRCm39) frame shift probably null
R4419:Bicc1 UTSW 10 70,782,804 (GRCm39) missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70,789,314 (GRCm39) missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70,771,661 (GRCm39) critical splice donor site probably null
R4765:Bicc1 UTSW 10 70,776,423 (GRCm39) missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70,781,146 (GRCm39) missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70,776,352 (GRCm39) missense probably benign 0.05
R5160:Bicc1 UTSW 10 70,768,066 (GRCm39) missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70,783,730 (GRCm39) missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70,776,350 (GRCm39) missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70,782,799 (GRCm39) missense probably benign 0.00
R6045:Bicc1 UTSW 10 70,792,911 (GRCm39) nonsense probably null
R6277:Bicc1 UTSW 10 70,863,731 (GRCm39) missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70,794,752 (GRCm39) missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70,796,978 (GRCm39) missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70,766,483 (GRCm39) missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7352:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7353:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7366:Bicc1 UTSW 10 70,779,216 (GRCm39) missense probably benign 0.01
R7480:Bicc1 UTSW 10 70,779,306 (GRCm39) missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70,782,434 (GRCm39) missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70,792,204 (GRCm39) missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70,792,121 (GRCm39) missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70,782,420 (GRCm39) missense probably benign
R7671:Bicc1 UTSW 10 70,792,997 (GRCm39) missense probably benign 0.01
R7747:Bicc1 UTSW 10 70,782,823 (GRCm39) missense probably benign
R8129:Bicc1 UTSW 10 70,915,033 (GRCm39) missense probably benign 0.01
R8270:Bicc1 UTSW 10 70,767,938 (GRCm39) missense probably damaging 0.99
R8525:Bicc1 UTSW 10 70,779,365 (GRCm39) missense possibly damaging 0.67
R8762:Bicc1 UTSW 10 70,779,216 (GRCm39) missense probably benign 0.03
R8849:Bicc1 UTSW 10 70,782,694 (GRCm39) missense probably benign 0.23
R9120:Bicc1 UTSW 10 70,776,862 (GRCm39) missense probably damaging 1.00
R9164:Bicc1 UTSW 10 70,781,094 (GRCm39) missense probably damaging 1.00
R9368:Bicc1 UTSW 10 70,785,917 (GRCm39) missense probably benign 0.13
R9452:Bicc1 UTSW 10 70,792,981 (GRCm39) missense probably damaging 0.99
R9497:Bicc1 UTSW 10 70,776,828 (GRCm39) critical splice donor site probably null
R9641:Bicc1 UTSW 10 70,863,772 (GRCm39) missense probably benign 0.01
R9672:Bicc1 UTSW 10 70,794,666 (GRCm39) missense probably damaging 1.00
RF013:Bicc1 UTSW 10 70,771,660 (GRCm39) critical splice donor site probably null
X0028:Bicc1 UTSW 10 70,781,166 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACTGCAGCTGCTCTTTG -3'
(R):5'- GAATGAAGAAACCTTGTTCCCC -3'

Sequencing Primer
(F):5'- ACCCCACTTTATCATGTAGGATAC -3'
(R):5'- TGAAGAAACCTTGTTCCCCCTCAG -3'
Posted On 2017-12-04