Incidental Mutation 'R6183:Helb'
ID 501826
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Name helicase (DNA) B
Synonyms D10Ertd664e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R6183 (G1)
Quality Score 97.0078
Status Not validated
Chromosome 10
Chromosomal Location 120083608-120112987 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 120112998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]
AlphaFold Q6NVF4
Predicted Effect probably null
Transcript: ENSMUST00000020449
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154501
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1423:Helb UTSW 10 120108966 missense probably damaging 0.99
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R2432:Helb UTSW 10 120105537 missense probably benign 0.01
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4734:Helb UTSW 10 120084849 missense probably benign
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5663:Helb UTSW 10 120105793 missense possibly damaging 0.61
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R5951:Helb UTSW 10 120091748 missense possibly damaging 0.91
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 splice site probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
R7114:Helb UTSW 10 120105256 missense probably benign 0.09
R7396:Helb UTSW 10 120089571 missense probably benign
R7422:Helb UTSW 10 120108894 missense probably damaging 1.00
R7508:Helb UTSW 10 120105283 missense probably benign 0.04
R7509:Helb UTSW 10 120089814 missense probably damaging 1.00
R7746:Helb UTSW 10 120095102 missense probably null 1.00
R8058:Helb UTSW 10 120105578 missense probably benign 0.00
R8074:Helb UTSW 10 120089416 missense probably benign 0.00
R8348:Helb UTSW 10 120102886 missense probably damaging 1.00
R8428:Helb UTSW 10 120091617 missense probably damaging 1.00
R8448:Helb UTSW 10 120102886 missense probably damaging 1.00
R8710:Helb UTSW 10 120105967 missense probably damaging 1.00
R8751:Helb UTSW 10 120089507 missense probably benign 0.01
R8815:Helb UTSW 10 120112787 missense possibly damaging 0.71
R8822:Helb UTSW 10 120105484 missense probably benign 0.01
R9031:Helb UTSW 10 120084885 missense possibly damaging 0.62
R9340:Helb UTSW 10 120092651 missense probably damaging 1.00
Z1177:Helb UTSW 10 120092690 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGTGAGAATCGAAAATACTTC -3'
(R):5'- CCCAAGAGTCGTGACCTTTC -3'

Sequencing Primer
(F):5'- AGAGTTCCTCGGCATCCAC -3'
(R):5'- GTGACCTTTCACCACGTCTC -3'
Posted On 2017-12-04