Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Helb'

501826

Institutional Source

Beutler Lab

Gene Symbol

Helb

Ensembl Gene

ENSMUSG00000020228

Gene Name

helicase (DNA) B

Synonyms

D10Ertd664e

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R6183 (G1)

Quality Score

97.0078

Status

Not validated

Chromosome

Chromosomal Location

120083608-120112987 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 120112998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]

AlphaFold

Q6NVF4

Predicted Effect

probably null
Transcript: ENSMUST00000020449

SMART Domains

Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228

Domain	Start	End	E-Value	Type
low complexity region	20	43	N/A	INTRINSIC
Pfam:AAA_30	434	661	4.8e-24	PFAM
Pfam:UvrD_C_2	855	901	2.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154501

SMART Domains

Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228

Domain	Start	End	E-Value	Type
low complexity region	20	43	N/A	INTRINSIC
Pfam:AAA_30	434	546	1.2e-8	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Helb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Helb	APN	10	120098245	missense	possibly damaging	0.88
IGL00516:Helb	APN	10	120105424	missense	probably damaging	1.00
IGL00924:Helb	APN	10	120110984	missense	probably benign	0.01
IGL00971:Helb	APN	10	120094263	missense	possibly damaging	0.50
IGL01142:Helb	APN	10	120111144	missense	probably damaging	1.00
IGL01483:Helb	APN	10	120111138	missense	probably damaging	1.00
IGL01688:Helb	APN	10	120108980	missense	probably damaging	0.99
IGL01860:Helb	APN	10	120102833	missense	probably damaging	0.97
IGL02298:Helb	APN	10	120101526	missense	probably damaging	1.00
IGL02501:Helb	APN	10	120102788	missense	possibly damaging	0.96
IGL02554:Helb	APN	10	120089712	missense	probably damaging	1.00
IGL02810:Helb	APN	10	120091703	missense	possibly damaging	0.48
IGL02902:Helb	APN	10	120089485	missense	probably benign	0.00
IGL03405:Helb	APN	10	120089796	missense	probably damaging	1.00
R0004:Helb	UTSW	10	120108981	missense	probably damaging	1.00
R0092:Helb	UTSW	10	120089808	missense	probably damaging	1.00
R0436:Helb	UTSW	10	120094212	splice site	probably benign
R0850:Helb	UTSW	10	120105367	missense	probably damaging	1.00
R1423:Helb	UTSW	10	120108966	missense	probably damaging	0.99
R1663:Helb	UTSW	10	120105433	missense	probably damaging	1.00
R1756:Helb	UTSW	10	120094242	missense	probably damaging	0.96
R1812:Helb	UTSW	10	120089566	nonsense	probably null
R1976:Helb	UTSW	10	120094263	missense	possibly damaging	0.50
R2049:Helb	UTSW	10	120106021	missense	possibly damaging	0.74
R2063:Helb	UTSW	10	120105766	missense	probably benign
R2141:Helb	UTSW	10	120106021	missense	possibly damaging	0.74
R2180:Helb	UTSW	10	120105448	missense	probably benign	0.02
R2432:Helb	UTSW	10	120105537	missense	probably benign	0.01
R3030:Helb	UTSW	10	120089582	nonsense	probably null
R3874:Helb	UTSW	10	120106037	missense	probably benign	0.31
R3978:Helb	UTSW	10	120089625	missense	probably benign
R4731:Helb	UTSW	10	120094288	critical splice acceptor site	probably null
R4734:Helb	UTSW	10	120084849	missense	probably benign
R4748:Helb	UTSW	10	120084849	missense	probably benign
R4749:Helb	UTSW	10	120084849	missense	probably benign
R4840:Helb	UTSW	10	120084858	missense	probably benign	0.33
R4977:Helb	UTSW	10	120110881	missense	probably benign	0.01
R5149:Helb	UTSW	10	120105743	missense	probably benign	0.39
R5220:Helb	UTSW	10	120101486	missense	probably damaging	1.00
R5447:Helb	UTSW	10	120102901	missense	possibly damaging	0.88
R5637:Helb	UTSW	10	120105448	missense	probably benign	0.02
R5660:Helb	UTSW	10	120111079	nonsense	probably null
R5663:Helb	UTSW	10	120105793	missense	possibly damaging	0.61
R5806:Helb	UTSW	10	120092519	missense	probably damaging	1.00
R5951:Helb	UTSW	10	120091748	missense	possibly damaging	0.91
R6010:Helb	UTSW	10	120105883	missense	probably damaging	1.00
R6578:Helb	UTSW	10	120111181	missense	probably damaging	1.00
R6642:Helb	UTSW	10	120084930	missense	probably benign	0.17
R6666:Helb	UTSW	10	120084951	missense	probably damaging	0.99
R6705:Helb	UTSW	10	120089811	splice site	probably null
R6746:Helb	UTSW	10	120105468	missense	probably damaging	1.00
R7114:Helb	UTSW	10	120105256	missense	probably benign	0.09
R7396:Helb	UTSW	10	120089571	missense	probably benign
R7422:Helb	UTSW	10	120108894	missense	probably damaging	1.00
R7508:Helb	UTSW	10	120105283	missense	probably benign	0.04
R7509:Helb	UTSW	10	120089814	missense	probably damaging	1.00
R7746:Helb	UTSW	10	120095102	missense	probably null	1.00
R8058:Helb	UTSW	10	120105578	missense	probably benign	0.00
R8074:Helb	UTSW	10	120089416	missense	probably benign	0.00
R8348:Helb	UTSW	10	120102886	missense	probably damaging	1.00
R8428:Helb	UTSW	10	120091617	missense	probably damaging	1.00
R8448:Helb	UTSW	10	120102886	missense	probably damaging	1.00
R8710:Helb	UTSW	10	120105967	missense	probably damaging	1.00
R8751:Helb	UTSW	10	120089507	missense	probably benign	0.01
R8815:Helb	UTSW	10	120112787	missense	possibly damaging	0.71
R8822:Helb	UTSW	10	120105484	missense	probably benign	0.01
R9031:Helb	UTSW	10	120084885	missense	possibly damaging	0.62
R9340:Helb	UTSW	10	120092651	missense	probably damaging	1.00
Z1177:Helb	UTSW	10	120092690	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCAGTGAGAATCGAAAATACTTC -3'
(R):5'- CCCAAGAGTCGTGACCTTTC -3'

Sequencing Primer
(F):5'- AGAGTTCCTCGGCATCCAC -3'
(R):5'- GTGACCTTTCACCACGTCTC -3'

Posted On

2017-12-04