Incidental Mutation 'R6175:Nlrp9c'
ID501828
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 26378001 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably null
Transcript: ENSMUST00000041845
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085944
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
R7999:Nlrp9c UTSW 7 26385489 missense possibly damaging 0.94
R8036:Nlrp9c UTSW 7 26371439 missense possibly damaging 0.49
R8056:Nlrp9c UTSW 7 26385687 missense probably damaging 1.00
R8249:Nlrp9c UTSW 7 26375353 nonsense probably null
RF020:Nlrp9c UTSW 7 26385224 missense probably benign
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Z1177:Nlrp9c UTSW 7 26382348 missense probably benign 0.28
Z1177:Nlrp9c UTSW 7 26384775 missense probably damaging 1.00
Z1177:Nlrp9c UTSW 7 26384825 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGAAGTAGCCTTGGCTTGTC -3'
(R):5'- TCACATGTAGGTTGGGAAAATGTG -3'

Sequencing Primer
(F):5'- AGAAGTAGCCTTGGCTTGTCTGAAC -3'
(R):5'- TGTAGGTTGGGAAAATGTGACATATC -3'
Posted On2017-12-04