Incidental Mutation 'R6177:Plxnb1'
ID501836
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationunclassified (2427 bp from exon)
DNA Base Change (assembly) C to T at 109102925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect probably null
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 109100175 missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7428:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7443:Plxnb1 UTSW 9 109114607 missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 109100861 missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 109100503 nonsense probably null
R7866:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 109109232 missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 109100505 missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 109112078 missense probably damaging 0.98
R8286:Plxnb1 UTSW 9 109106802 missense probably damaging 1.00
R8290:Plxnb1 UTSW 9 109109619 missense probably benign 0.00
Z1177:Plxnb1 UTSW 9 109108921 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CTACTGTAAGTCCTGGACACAG -3'
(R):5'- TACCAGGCTCTTGTGTCTGC -3'

Sequencing Primer
(F):5'- CTTCTGGGCAGATACTGGGAC -3'
(R):5'- TGCTATGGCAGGGAGCTAAAGC -3'
Posted On2017-12-04