Incidental Mutation 'R6177:Epb41l4a'
List |< first << previous [record 18 of 64] next >> last >|
ID501837
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 33798815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably null
Transcript: ENSMUST00000025234
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179138
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGACAGAACTCAGGTCTTATGC -3'
(R):5'- GCTGTGAAATTTACTGCTTTCAGAG -3'

Sequencing Primer
(F):5'- AGAACTCAGGTCTTATGCGCCTC -3'
(R):5'- GCGGAGGAACATGCTTTTAATTCAG -3'
Posted On2017-12-04