Mutagenetix > Incidental Mutation

Incidental Mutation 'R6178:Clspn'

501838

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

044320-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6178 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 126577736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

silent
Transcript: ENSMUST00000048391

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128202

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146944

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,029,044	I61V	probably benign	Het
Afg3l2	G	A	18: 67,409,528	T616I	possibly damaging	Het
Aktip	T	C	8: 91,126,043	N195S	probably damaging	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Atg7	T	A	6: 114,724,895	I621N	probably damaging	Het
Becn1	T	A	11: 101,291,510	I283F	probably damaging	Het
C4b	T	C	17: 34,733,406	T1220A	probably benign	Het
Celsr1	C	A	15: 85,901,021	R3004M	probably benign	Het
Csmd3	T	C	15: 48,673,458	Y116C	probably damaging	Het
Dcp1a	T	G	14: 30,523,304	*603G	probably null	Het
Dmrtc1b	C	T	X: 102,713,563	P205S	possibly damaging	Het
Fev	G	T	1: 74,884,539		probably benign	Het
Fry	T	A	5: 150,454,522	V393E	probably damaging	Het
Gm30646	A	G	7: 30,432,656		probably null	Het
Gm36028	T	C	16: 37,856,060	Y115C	probably damaging	Het
Gm3676	C	T	14: 41,641,495	E175K	probably benign	Het
Gm4847	T	C	1: 166,642,336	Y56C	probably damaging	Het
Gm5422	T	C	10: 31,249,692		noncoding transcript	Het
Gstm6	A	G	3: 107,941,081	V174A	probably benign	Het
Isoc1	G	T	18: 58,671,592	V191F	possibly damaging	Het
Kalrn	T	A	16: 34,053,639	D132V	possibly damaging	Het
Kcp	T	C	6: 29,482,888	D1394G	possibly damaging	Het
March10	T	G	11: 105,389,614	D615A	probably damaging	Het
Mau2	A	G	8: 70,042,537	I50T	probably damaging	Het
Mgp	A	G	6: 136,872,724	C79R	probably damaging	Het
Mpdz	T	A	4: 81,308,365	K1344N	probably damaging	Het
Mrgpre	T	A	7: 143,780,971	Y265F	possibly damaging	Het
Mro	G	A	18: 73,873,224	V80M	possibly damaging	Het
Mrpl44	G	T	1: 79,778,178	C167F	possibly damaging	Het
Muc5b	A	G	7: 141,856,342	M1218V	probably null	Het
Naa16	T	C	14: 79,383,340	I100V	possibly damaging	Het
Nup205	A	T	6: 35,243,843	Y1860F	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1195	T	C	2: 88,683,633	Y33C	probably damaging	Het
Olfr293	A	G	7: 86,664,611	I316M	probably benign	Het
Olfr432	A	T	1: 174,050,967	Y198F	probably benign	Het
Plcb3	A	G	19: 6,954,703		probably null	Het
Pnpla3	G	A	15: 84,180,931	A309T	probably benign	Het
Ranbp10	A	G	8: 105,771,664	S624P	possibly damaging	Het
Ripor2	T	C	13: 24,710,130	S714P	possibly damaging	Het
Robo4	C	T	9: 37,405,630	Q414*	probably null	Het
Shc2	A	G	10: 79,630,120	I161T	probably damaging	Het
Slc35b2	C	T	17: 45,566,376	T143I	probably benign	Het
Slc39a13	T	C	2: 91,068,535	D77G	probably damaging	Het
Snx6	A	C	12: 54,760,464	D243E	probably damaging	Het
Taar8b	A	G	10: 24,091,813	V161A	probably benign	Het
Tbr1	T	A	2: 61,804,815	D36E	possibly damaging	Het
Tdpoz2	T	C	3: 93,652,311	N118S	probably benign	Het
Tgfb1i1	T	C	7: 128,253,345	F478L	probably damaging	Het
Tmprss11f	T	C	5: 86,556,978	D27G	probably benign	Het
Trim30d	T	G	7: 104,487,995	M1L	probably damaging	Het
Trpm7	A	G	2: 126,837,381	V420A	probably damaging	Het
Ubap2	G	T	4: 41,206,981	P199H	probably benign	Het
Ubash3b	T	C	9: 41,014,916	T512A	probably damaging	Het
Zfp65	G	A	13: 67,710,318	P76S	probably benign	Het
Zic5	A	T	14: 122,459,336	H622Q	unknown	Het
Zpld1	A	T	16: 55,233,630	N266K	probably damaging	Het
Zswim1	A	G	2: 164,826,052		probably null	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGCTTCTAACCCTGGTGC -3'
(R):5'- TGTGCACTTACAGAGAGGGG -3'

Sequencing Primer
(F):5'- CTTCTAACCCTGGTGCTGGAAG -3'
(R):5'- AAGAGCTTCTTTCCGGGGAC -3'

Posted On

2017-12-04