Mutagenetix > Incidental Mutations

Incidental Mutation 'R6142:Akap12'

501857

Institutional Source

Beutler Lab

Gene Symbol

Akap12

Ensembl Gene

ENSMUSG00000038587

Gene Name

A kinase (PRKA) anchor protein (gravin) 12

Synonyms

SSeCKS, Tsga12, Srcs5

MMRRC Submission

044289-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R6142 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4266380-4359470 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 4313740 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045730]

Predicted Effect

probably null
Transcript: ENSMUST00000045730

SMART Domains

Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	151	171	N/A	INTRINSIC
low complexity region	187	198	N/A	INTRINSIC
internal_repeat_1	212	279	3.2e-5	PROSPERO
coiled coil region	304	331	N/A	INTRINSIC
low complexity region	387	398	N/A	INTRINSIC
low complexity region	407	424	N/A	INTRINSIC
low complexity region	432	446	N/A	INTRINSIC
low complexity region	497	526	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	571	582	N/A	INTRINSIC
Pfam:WSK	591	619	2e-15	PFAM
low complexity region	626	637	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
low complexity region	700	711	N/A	INTRINSIC
Pfam:WSK	738	766	2.3e-15	PFAM
Pfam:WSK	779	807	6.2e-11	PFAM
low complexity region	951	973	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
internal_repeat_1	1197	1265	3.2e-5	PROSPERO
low complexity region	1303	1312	N/A	INTRINSIC
Pfam:RII_binding_1	1501	1518	4.2e-7	PFAM
coiled coil region	1651	1676	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.2%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	T	C	15: 98,598,422	M579V	probably benign	Het
Agtr1b	T	C	3: 20,316,394	D16G	probably benign	Het
Alpk2	T	C	18: 65,305,385	E979G	possibly damaging	Het
Arfgap3	T	C	15: 83,350,127	D8G	probably damaging	Het
AW551984	G	T	9: 39,597,114	L369I	probably benign	Het
Bmp8b	A	T	4: 123,115,250	H207L	probably benign	Het
Cc2d2a	G	T	5: 43,703,198	V490F	probably damaging	Het
Cnot6l	C	T	5: 96,082,978	V377I	probably benign	Het
Col25a1	T	A	3: 130,583,329		probably benign	Het
Crocc2	C	G	1: 93,190,479	Q375E	possibly damaging	Het
Ganc	T	C	2: 120,430,737		probably null	Het
Gm28168	C	A	1: 117,947,948	D102E	probably benign	Het
Gm8212	T	C	14: 44,201,227		probably null	Het
Gria2	T	C	3: 80,801,717	T53A	probably benign	Het
Hipk4	G	A	7: 27,529,165	V347M	probably damaging	Het
Hmgxb3	T	C	18: 61,136,237	E991G	probably benign	Het
Hyal1	G	A	9: 107,579,374	R420H	probably benign	Het
Il5	G	A	11: 53,720,978		probably null	Het
Kcnh7	T	C	2: 62,739,360	I731V	possibly damaging	Het
Lamb2	A	T	9: 108,485,618	K759*	probably null	Het
Lnpep	A	G	17: 17,566,681		probably null	Het
Lrch1	T	C	14: 74,947,500	E54G	probably damaging	Het
Msl3l2	A	G	10: 56,115,365	D62G	possibly damaging	Het
Mslnl	T	C	17: 25,744,557	L339P	probably damaging	Het
Nfe2l2	T	C	2: 75,679,417	I20V	probably damaging	Het
Pgm5	A	C	19: 24,824,408	I152S	probably damaging	Het
Plcg2	C	A	8: 117,585,271	T434K	probably benign	Het
Prrc2c	T	C	1: 162,710,387	E558G	unknown	Het
Ranbp3	T	C	17: 56,686,018	V12A	probably benign	Het
Rgsl1	A	G	1: 153,812,238	V635A	probably benign	Het
Rpap2	T	C	5: 107,598,298	V14A	probably benign	Het
Rxrg	G	T	1: 167,632,622	A341S	possibly damaging	Het
Sbf2	A	G	7: 110,348,975	S1177P	probably damaging	Het
Sema6a	T	C	18: 47,281,199	T498A	probably benign	Het
Slc13a4	G	A	6: 35,301,783	A57V	probably damaging	Het
Slc6a3	A	T	13: 73,544,783	D174V	probably benign	Het
Spg20	T	G	3: 55,117,248	V88G	probably damaging	Het
Tanc1	A	T	2: 59,833,222	R1108*	probably null	Het
Tas2r140	C	T	6: 133,055,735	G20E	probably damaging	Het
Tdrd6	A	G	17: 43,629,482	V225A	probably benign	Het
Tmem168	C	A	6: 13,591,369	A99S	probably benign	Het
Tnk2	T	A	16: 32,670,099	D252E	probably damaging	Het
Tpsg1	A	T	17: 25,372,486	H20L	probably benign	Het
Tram1l1	T	C	3: 124,321,443	F84S	probably damaging	Het
Vmn2r12	T	A	5: 109,092,897	I117L	probably benign	Het
Zfp148	T	C	16: 33,495,459	L219S	possibly damaging	Het
Zfp40	C	A	17: 23,176,337	E425D	probably benign	Het
Zfp773	T	C	7: 7,132,482	T372A	probably benign	Het

Other mutations in Akap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00712:Akap12	APN	10	4357164	missense	probably benign	0.09
IGL01306:Akap12	APN	10	4353273	missense	probably benign	0.04
IGL01360:Akap12	APN	10	4357537	missense	probably benign	0.02
IGL01455:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL01458:Akap12	APN	10	4354060	missense	probably damaging	1.00
IGL01465:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL02348:Akap12	APN	10	4354722	missense	probably damaging	1.00
IGL02425:Akap12	APN	10	4356034	missense	possibly damaging	0.67
IGL02502:Akap12	APN	10	4353163	missense	probably damaging	1.00
IGL02736:Akap12	APN	10	4355637	missense	probably benign
IGL02969:Akap12	APN	10	4354864	missense	probably damaging	1.00
IGL03345:Akap12	APN	10	4356697	missense	probably benign	0.42
ANU23:Akap12	UTSW	10	4353273	missense	probably benign	0.04
FR4976:Akap12	UTSW	10	4353837	small insertion	probably benign
R0004:Akap12	UTSW	10	4353218	missense	possibly damaging	0.56
R0004:Akap12	UTSW	10	4353220	missense	probably damaging	1.00
R0207:Akap12	UTSW	10	4353333	missense	probably damaging	1.00
R0580:Akap12	UTSW	10	4354741	missense	possibly damaging	0.91
R0675:Akap12	UTSW	10	4353315	missense	probably benign	0.06
R1248:Akap12	UTSW	10	4353847	missense	probably benign	0.11
R1338:Akap12	UTSW	10	4313773	missense	possibly damaging	0.95
R1448:Akap12	UTSW	10	4355475	missense	probably benign	0.22
R1458:Akap12	UTSW	10	4353693	missense	probably damaging	1.00
R1521:Akap12	UTSW	10	4354804	missense	probably benign	0.02
R1585:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R1725:Akap12	UTSW	10	4353942	missense	probably damaging	1.00
R1756:Akap12	UTSW	10	4357574	missense	probably benign	0.04
R1914:Akap12	UTSW	10	4356685	missense	probably benign	0.01
R1978:Akap12	UTSW	10	4313855	missense	probably benign	0.06
R2032:Akap12	UTSW	10	4356673	missense	possibly damaging	0.50
R2041:Akap12	UTSW	10	4356489	missense	probably benign	0.01
R3009:Akap12	UTSW	10	4357891	missense	probably benign	0.06
R3872:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3874:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3875:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3944:Akap12	UTSW	10	4357347	missense	probably benign	0.00
R4612:Akap12	UTSW	10	4354456	missense	probably damaging	1.00
R4889:Akap12	UTSW	10	4356535	missense	probably damaging	0.97
R5043:Akap12	UTSW	10	4355047	missense	probably damaging	1.00
R5176:Akap12	UTSW	10	4353947	missense	probably benign	0.19
R5278:Akap12	UTSW	10	4354792	missense	probably benign	0.02
R5320:Akap12	UTSW	10	4357291	missense	probably benign	0.00
R5443:Akap12	UTSW	10	4355576	missense	probably damaging	1.00
R5533:Akap12	UTSW	10	4357405	missense	probably damaging	1.00
R6133:Akap12	UTSW	10	4355178	missense	probably benign	0.05
R6190:Akap12	UTSW	10	4356268	missense	possibly damaging	0.92
R6458:Akap12	UTSW	10	4355148	missense	probably damaging	1.00
R6562:Akap12	UTSW	10	4356141	nonsense	probably null
R6701:Akap12	UTSW	10	4355243	missense	probably damaging	1.00
R6828:Akap12	UTSW	10	4354606	missense	probably damaging	0.96
R6991:Akap12	UTSW	10	4357122	nonsense	probably null
R7023:Akap12	UTSW	10	4356895	missense	probably benign	0.05
R7102:Akap12	UTSW	10	4353226	missense	probably damaging	1.00
R7483:Akap12	UTSW	10	4353967	missense	probably benign	0.00
R7538:Akap12	UTSW	10	4353213	missense	probably damaging	1.00
R7664:Akap12	UTSW	10	4353748	missense	probably damaging	1.00
R7704:Akap12	UTSW	10	4356082	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCAAGGGTCAATCTTTTGG -3'
(R):5'- AAGTGCAGTCTACCCTCCAG -3'

Sequencing Primer
(F):5'- CTTTTGGTGACAGAACATCAGG -3'
(R):5'- GCTCCCAATGTCCTGCCAAAG -3'

Posted On

2017-12-04