Incidental Mutation 'R6142:Akap12'
ID501857
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene NameA kinase (PRKA) anchor protein (gravin) 12
SynonymsSSeCKS, Tsga12, Srcs5
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location4266380-4359470 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 4313740 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730]
Predicted Effect probably null
Transcript: ENSMUST00000045730
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0004:Akap12 UTSW 10 4353220 missense probably damaging 1.00
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1248:Akap12 UTSW 10 4353847 missense probably benign 0.11
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3874:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R5533:Akap12 UTSW 10 4357405 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
R7704:Akap12 UTSW 10 4356082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAAGGGTCAATCTTTTGG -3'
(R):5'- AAGTGCAGTCTACCCTCCAG -3'

Sequencing Primer
(F):5'- CTTTTGGTGACAGAACATCAGG -3'
(R):5'- GCTCCCAATGTCCTGCCAAAG -3'
Posted On2017-12-04