Mutagenetix > Incidental Mutation

Incidental Mutation 'R6145:Otogl'

501865

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

044292-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

synonymous

DNA Base Change (assembly)

G to A at 107777117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341] [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

silent
Transcript: ENSMUST00000165341

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Predicted Effect

silent
Transcript: ENSMUST00000165341

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	A	1: 86,052,942		probably null	Het
4930402H24Rik	T	C	2: 130,778,473	I247V	probably benign	Het
Abca8b	A	G	11: 109,973,808	V316A	probably benign	Het
Acad10	A	T	5: 121,622,033	V999D	probably damaging	Het
Acot8	A	G	2: 164,803,065	V66A	probably benign	Het
Ankrd11	T	C	8: 122,892,661	H1484R	probably damaging	Het
Anxa6	A	G	11: 54,994,904	F405S	probably damaging	Het
Asmt	G	A	X: 170,674,663	V101I	probably damaging	Het
Atp1a2	C	T	1: 172,287,238	V327I	probably damaging	Het
Brdt	A	G	5: 107,377,999	E906G	possibly damaging	Het
Cacna1g	A	T	11: 94,462,261	C313S	probably damaging	Het
Camk2d	T	C	3: 126,805,858	I329T	probably benign	Het
Cavin4	A	T	4: 48,663,794	H58L	probably damaging	Het
Ccdc78	C	A	17: 25,789,065	P317T	probably benign	Het
Cdc16	T	G	8: 13,767,573	Y295D	possibly damaging	Het
Cdyl2	T	A	8: 116,594,978	N270I	probably damaging	Het
Cfap221	T	A	1: 119,984,816	I114F	possibly damaging	Het
Dmxl1	A	G	18: 49,912,766	E2414G	possibly damaging	Het
Dnah1	C	A	14: 31,300,970	R1070L	probably benign	Het
Dnah14	T	C	1: 181,666,417	S1713P	probably benign	Het
Dock10	C	A	1: 80,575,904	G602*	probably null	Het
Ep400	A	T	5: 110,756,703	V10D	possibly damaging	Het
Epas1	T	C	17: 86,829,429	C807R	probably benign	Het
Esrrb	C	T	12: 86,505,899	P200L	probably benign	Het
Fbxw26	T	C	9: 109,732,623	I168V	probably benign	Het
Fsip2	A	T	2: 82,993,768	H6615L	possibly damaging	Het
Galk2	A	T	2: 125,946,842	Q272L	possibly damaging	Het
Gas7	A	C	11: 67,629,612	T43P	probably damaging	Het
Gm5134	A	T	10: 75,995,839	I371F	probably damaging	Het
Gpr31b	C	T	17: 13,051,379	R301Q	possibly damaging	Het
Grk1	T	A	8: 13,405,765	Y216*	probably null	Het
Grm5	T	A	7: 88,026,601	M441K	probably damaging	Het
Heatr6	A	G	11: 83,766,136	E408G	probably damaging	Het
Hoxc9	G	T	15: 102,983,959	K201N	probably damaging	Het
Igsf10	T	A	3: 59,331,656	Y368F	possibly damaging	Het
Il2ra	A	T	2: 11,680,246	D131V	probably damaging	Het
Imp4	A	G	1: 34,440,096	E19G	probably benign	Het
Kcnk18	T	C	19: 59,235,607	*395Q	probably null	Het
Kdm6b	A	T	11: 69,405,026	L805Q	unknown	Het
Lgr4	T	A	2: 110,007,243	L427*	probably null	Het
Myt1l	G	A	12: 29,832,381	S525N	unknown	Het
Nasp	G	A	4: 116,611,077	T237I	probably benign	Het
Nell2	G	T	15: 95,473,561	Q98K	probably damaging	Het
Nfasc	C	T	1: 132,634,717	G107R	probably damaging	Het
Nsun4	A	G	4: 116,040,206	S203P	probably damaging	Het
Olfr24	T	G	9: 18,755,569	D22A	probably benign	Het
Olfr855	T	C	9: 19,584,888	V117A	probably benign	Het
Pde10a	T	C	17: 8,929,117	V366A	probably damaging	Het
Pdxk	T	A	10: 78,443,791	D250V	probably benign	Het
Pih1d1	T	A	7: 45,159,044	I179N	probably damaging	Het
Plaa	T	A	4: 94,583,992	I294F	probably damaging	Het
Pmel	C	A	10: 128,715,935	P213T	probably damaging	Het
Pom121l2	A	T	13: 21,982,302	R248*	probably null	Het
Pou2f1	T	C	1: 165,875,433		probably benign	Het
Ppm1j	G	A	3: 104,781,379	R98H	probably damaging	Het
Prkdc	C	T	16: 15,772,073	P2600L	probably damaging	Het
Prom1	T	C	5: 44,029,649	N422S	probably benign	Het
Pspn	C	T	17: 56,999,467	C154Y	probably damaging	Het
Ptdss1	T	C	13: 66,972,637		probably null	Het
Rapgef1	A	G	2: 29,736,666	Y993C	probably damaging	Het
Scrn2	A	C	11: 97,032,853	T219P	probably benign	Het
Sec23ip	T	G	7: 128,778,484	S874R	probably damaging	Het
Sept4	G	A	11: 87,585,246		probably null	Het
Slc15a3	C	T	19: 10,857,251	L499F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sra1	A	G	18: 36,667,575	M193T	probably damaging	Het
Srsf4	G	T	4: 131,900,294		probably benign	Het
Syne1	T	C	10: 5,052,750	D8055G	probably damaging	Het
Syne4	T	A	7: 30,316,563		probably null	Het
Tbc1d24	C	A	17: 24,208,229	G253V	probably damaging	Het
Tbck	T	A	3: 132,732,215	I467N	probably damaging	Het
Tln1	T	A	4: 43,538,030	M1857L	possibly damaging	Het
Ttll2	T	C	17: 7,351,632	R299G	probably benign	Het
Ugt2b36	T	G	5: 87,066,213	E524A	probably benign	Het
Vmn2r124	C	T	17: 18,062,851	T269I	probably benign	Het
Vmn2r4	A	G	3: 64,406,943	F206L	probably benign	Het
Zfp346	A	G	13: 55,115,574	K156R	probably damaging	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCCTGCTTCATTTTAAGGACAGTC -3'
(R):5'- CCATCACTTGAGTGTGCAAAAG -3'

Sequencing Primer
(F):5'- ATTGGCCTGAACTCACCATGTAG -3'
(R):5'- CTTGAGTGTGCAAAAGATATGAACC -3'

Posted On

2017-12-04