Incidental Mutation 'R6173:Zp3r'
ID501874
Institutional Source Beutler Lab
Gene Symbol Zp3r
Ensembl Gene ENSMUSG00000042554
Gene Namezona pellucida 3 receptor
SynonymsSP56
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130576713-130629621 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 130591568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039862] [ENSMUST00000128128] [ENSMUST00000142416]
Predicted Effect probably null
Transcript: ENSMUST00000039862
SMART Domains Protein: ENSMUSP00000045443
Gene: ENSMUSG00000042554

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 218 8.23e-12 SMART
CCP 223 278 1.77e-11 SMART
CCP 283 345 5.32e-6 SMART
CCP 350 411 3.67e-9 SMART
CCP 456 509 6.95e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082461
Predicted Effect probably null
Transcript: ENSMUST00000128128
SMART Domains Protein: ENSMUSP00000114401
Gene: ENSMUSG00000042554

DomainStartEndE-ValueType
CCP 55 112 2.52e-7 SMART
CCP 117 174 3.17e-13 SMART
CCP 179 234 1.77e-11 SMART
CCP 239 301 5.32e-6 SMART
CCP 306 367 3.67e-9 SMART
CCP 412 465 6.95e-10 SMART
PDB:4B0F|G 468 513 8e-8 PDB
Predicted Effect probably null
Transcript: ENSMUST00000142416
SMART Domains Protein: ENSMUSP00000118784
Gene: ENSMUSG00000042554

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 213 1.77e-11 SMART
CCP 218 280 5.32e-6 SMART
CCP 285 346 3.67e-9 SMART
CCP 391 444 6.95e-10 SMART
PDB:4B0F|G 447 492 8e-8 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and sperm morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Other mutations in Zp3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Zp3r APN 1 130619356 missense possibly damaging 0.88
IGL01783:Zp3r APN 1 130598866 missense possibly damaging 0.72
IGL01820:Zp3r APN 1 130598920 missense probably benign 0.01
IGL01959:Zp3r APN 1 130591451 nonsense probably null
IGL01978:Zp3r APN 1 130598941 missense probably damaging 1.00
IGL02232:Zp3r APN 1 130596667 missense probably damaging 1.00
IGL02290:Zp3r APN 1 130619365 missense possibly damaging 0.89
IGL02878:Zp3r APN 1 130582851 missense probably benign 0.02
IGL02960:Zp3r APN 1 130583438 missense possibly damaging 0.67
BB006:Zp3r UTSW 1 130591480 missense probably benign 0.31
BB016:Zp3r UTSW 1 130591480 missense probably benign 0.31
PIT4403001:Zp3r UTSW 1 130582872 missense possibly damaging 0.93
R0433:Zp3r UTSW 1 130577133 splice site probably benign
R0491:Zp3r UTSW 1 130618334 missense probably damaging 1.00
R0781:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1110:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1126:Zp3r UTSW 1 130618342 missense probably damaging 1.00
R1295:Zp3r UTSW 1 130591444 missense probably damaging 1.00
R1680:Zp3r UTSW 1 130582880 missense probably benign 0.15
R1728:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1728:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1729:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1729:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1730:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1730:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1739:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1739:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1762:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1762:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1783:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1783:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1784:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1784:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1785:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1785:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R3942:Zp3r UTSW 1 130577054 missense possibly damaging 0.94
R4429:Zp3r UTSW 1 130591391 missense possibly damaging 0.95
R4571:Zp3r UTSW 1 130578020 missense probably damaging 1.00
R4626:Zp3r UTSW 1 130615175 missense probably damaging 1.00
R4647:Zp3r UTSW 1 130577960 missense probably damaging 1.00
R4790:Zp3r UTSW 1 130582892 missense probably damaging 1.00
R4815:Zp3r UTSW 1 130598912 missense probably damaging 1.00
R5355:Zp3r UTSW 1 130596781 missense probably benign 0.09
R5554:Zp3r UTSW 1 130583471 missense probably benign 0.42
R5629:Zp3r UTSW 1 130582879 missense probably damaging 0.99
R6154:Zp3r UTSW 1 130598905 missense probably damaging 1.00
R6949:Zp3r UTSW 1 130577895 missense probably benign 0.00
R7346:Zp3r UTSW 1 130583480 missense probably benign 0.02
R7399:Zp3r UTSW 1 130577053 missense probably damaging 0.98
R7929:Zp3r UTSW 1 130591480 missense probably benign 0.31
R7944:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R7945:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R8367:Zp3r UTSW 1 130598873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGACAAGTCACAGTCTGG -3'
(R):5'- TGTTAACCCTTTAGTCACTGGTTAC -3'

Sequencing Primer
(F):5'- GGGATCGTTAAGACTTGCTCGATAAC -3'
(R):5'- GTCACTGGTTACTTTTAATACTCTGG -3'
Posted On2017-12-04