Incidental Mutation 'R6150:Pmpcb'
ID501876
Institutional Source Beutler Lab
Gene Symbol Pmpcb
Ensembl Gene ENSMUSG00000029017
Gene Namepeptidase (mitochondrial processing) beta
SynonymsMPPP52, MPP11, 3110004O18Rik
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6150 (G1)
Quality Score190.009
Status Validated
Chromosome5
Chromosomal Location21737141-21757152 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 21737139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030882] [ENSMUST00000030882] [ENSMUST00000149648]
Predicted Effect probably null
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147236
Predicted Effect probably benign
Transcript: ENSMUST00000149648
SMART Domains Protein: ENSMUSP00000119619
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 50 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruptin exhibit embryonic lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Pmpcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Pmpcb APN 5 21740478 splice site probably benign
IGL02123:Pmpcb APN 5 21743375 unclassified probably benign
IGL03271:Pmpcb APN 5 21738876 missense probably benign
PIT4504001:Pmpcb UTSW 5 21743390 missense probably damaging 0.97
PIT4651001:Pmpcb UTSW 5 21746050 missense probably benign 0.00
R0104:Pmpcb UTSW 5 21746038 nonsense probably null
R0157:Pmpcb UTSW 5 21742952 missense probably damaging 1.00
R0374:Pmpcb UTSW 5 21748831 missense probably damaging 1.00
R0842:Pmpcb UTSW 5 21748774 missense possibly damaging 0.95
R4868:Pmpcb UTSW 5 21748853 nonsense probably null
R4888:Pmpcb UTSW 5 21740662 intron probably benign
R4970:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5112:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5618:Pmpcb UTSW 5 21742788 missense possibly damaging 0.73
R5658:Pmpcb UTSW 5 21739001 missense probably damaging 0.99
R5875:Pmpcb UTSW 5 21742946 missense probably benign 0.04
R6175:Pmpcb UTSW 5 21757033 missense probably benign
R7201:Pmpcb UTSW 5 21737179 start codon destroyed probably null 0.02
R7450:Pmpcb UTSW 5 21746985 missense possibly damaging 0.46
R7764:Pmpcb UTSW 5 21743452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAACTCCAACCGCCTGGG -3'
(R):5'- ACTGAGGTTGACGCTGTCTG -3'

Sequencing Primer
(F):5'- AACCGCCTGGGGATACATGTTC -3'
(R):5'- TCCATGGGCTGAGGATGGC -3'
Posted On2017-12-04