Mutagenetix > Incidental Mutations

Incidental Mutation 'R6150:Pmpcb'

501876

Institutional Source

Beutler Lab

Gene Symbol

Pmpcb

Ensembl Gene

ENSMUSG00000029017

Gene Name

peptidase (mitochondrial processing) beta

Synonyms

MPPP52, MPP11, 3110004O18Rik

MMRRC Submission

044297-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6150 (G1)

Quality Score

190.009

Status

Validated

Chromosome

Chromosomal Location

21737141-21757152 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 21737139 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030882] [ENSMUST00000030882] [ENSMUST00000149648]

Predicted Effect

probably null
Transcript: ENSMUST00000030882

SMART Domains

Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
Pfam:Peptidase_M16	68	215	6.1e-59	PFAM
Pfam:Peptidase_M16_C	220	404	4.1e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000030882

SMART Domains

Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
Pfam:Peptidase_M16	68	215	6.1e-59	PFAM
Pfam:Peptidase_M16_C	220	404	4.1e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147236

Predicted Effect

probably benign
Transcript: ENSMUST00000149648

SMART Domains

Protein: ENSMUSP00000119619
Gene: ENSMUSG00000029017

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	1	50	2.5e-19	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruptin exhibit embryonic lethality at E8. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	A	G	11: 61,213,508	T74A	probably benign	Het
Arhgef1	T	C	7: 24,919,357		probably null	Het
Art1	C	G	7: 102,107,087	R162G	probably benign	Het
Boll	T	A	1: 55,270,653	I280F	possibly damaging	Het
Cep44	T	C	8: 56,539,805	E258G	probably benign	Het
Cutc	T	A	19: 43,759,889	V75E	probably damaging	Het
Dtx1	T	C	5: 120,681,363	K590R	probably damaging	Het
Eps8	A	T	6: 137,517,174	D295E	probably damaging	Het
Erc2	C	A	14: 28,141,291	S491Y	probably damaging	Het
F2rl3	G	T	8: 72,762,738	A198S	probably benign	Het
Fam83b	G	A	9: 76,492,357	T488M	probably damaging	Het
Fitm2	A	G	2: 163,470,074	L73P	probably damaging	Het
Fxyd1	T	C	7: 31,054,803		probably null	Het
Gm17186	T	C	14: 51,680,726		noncoding transcript	Het
Hivep3	C	A	4: 119,734,077	S94*	probably null	Het
Ifna1	T	A	4: 88,850,112	M9K	probably null	Het
Igsf11	G	A	16: 39,023,349	E275K	probably damaging	Het
Itga1	G	A	13: 114,968,233	L1086F	probably benign	Het
Itgav	T	C	2: 83,776,436	S374P	probably benign	Het
Jmy	A	T	13: 93,441,133	N842K	probably benign	Het
Kcnh6	G	A	11: 106,020,731	V595M	possibly damaging	Het
Kif13b	T	A	14: 64,751,639	I823N	probably damaging	Het
Kif26b	T	C	1: 178,915,546	L1069P	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Kmt2b	G	T	7: 30,588,477		probably benign	Het
Map10	G	A	8: 125,671,589	D574N	probably damaging	Het
Mau2	A	T	8: 70,019,837	H565Q	probably benign	Het
Myb	A	G	10: 21,141,769	I641T	probably damaging	Het
Naaladl2	C	A	3: 24,552,050	G15V	probably null	Het
Olfr370	G	A	8: 83,541,153	C3Y	probably benign	Het
Olfr399	A	C	11: 74,054,319	S147A	probably benign	Het
Olfr800	A	G	10: 129,659,934	I43V	probably benign	Het
Olfr867	A	T	9: 20,054,874	N78K	probably benign	Het
Otog	A	G	7: 46,264,059	E772G	possibly damaging	Het
Pla2g4d	T	C	2: 120,269,564	D674G	probably damaging	Het
Pomk	A	G	8: 25,983,256	V223A	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Serpina1e	A	G	12: 103,950,807	V201A	probably benign	Het
Six5	C	T	7: 19,097,521	P646S	probably benign	Het
Slc17a9	A	G	2: 180,737,628	I298V	probably benign	Het
Slc37a2	G	T	9: 37,238,347	T188K	probably damaging	Het
Slc6a11	T	A	6: 114,245,618	F525I	probably benign	Het
Slit2	A	T	5: 48,304,174	D1504V	probably damaging	Het
Srcap	T	A	7: 127,534,828	M907K	probably damaging	Het
Sspo	T	C	6: 48,486,379	L3746P	probably benign	Het
Supv3l1	A	T	10: 62,435,722	N376K	possibly damaging	Het
Tekt3	A	T	11: 63,094,657	T430S	possibly damaging	Het
Tex2	A	T	11: 106,567,080	V508D	probably benign	Het
Tmem184c	G	T	8: 77,596,440	Q598K	probably benign	Het
Ube2v1	G	A	2: 167,617,954	R42*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vangl1	T	C	3: 102,184,519	T84A	probably damaging	Het
Vgll3	T	A	16: 65,828,178		probably null	Het
Vmn1r61	T	A	7: 5,610,679	H212L	probably benign	Het
Vmn2r114	A	G	17: 23,291,295	V737A	probably benign	Het
Vmn2r35	A	T	7: 7,786,556	D727E	probably damaging	Het
Vps18	T	A	2: 119,297,592	Y965*	probably null	Het
Zfp521	A	T	18: 13,844,078	C1093S	probably damaging	Het
Zfp971	A	C	2: 178,033,454	H282P	probably benign	Het

Other mutations in Pmpcb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01146:Pmpcb	APN	5	21740478	splice site	probably benign
IGL02123:Pmpcb	APN	5	21743375	unclassified	probably benign
IGL03271:Pmpcb	APN	5	21738876	missense	probably benign
PIT4504001:Pmpcb	UTSW	5	21743390	missense	probably damaging	0.97
PIT4651001:Pmpcb	UTSW	5	21746050	missense	probably benign	0.00
R0104:Pmpcb	UTSW	5	21746038	nonsense	probably null
R0157:Pmpcb	UTSW	5	21742952	missense	probably damaging	1.00
R0374:Pmpcb	UTSW	5	21748831	missense	probably damaging	1.00
R0842:Pmpcb	UTSW	5	21748774	missense	possibly damaging	0.95
R4868:Pmpcb	UTSW	5	21748853	nonsense	probably null
R4888:Pmpcb	UTSW	5	21740662	intron	probably benign
R4970:Pmpcb	UTSW	5	21756443	missense	probably damaging	1.00
R5112:Pmpcb	UTSW	5	21756443	missense	probably damaging	1.00
R5618:Pmpcb	UTSW	5	21742788	missense	possibly damaging	0.73
R5658:Pmpcb	UTSW	5	21739001	missense	probably damaging	0.99
R5875:Pmpcb	UTSW	5	21742946	missense	probably benign	0.04
R6175:Pmpcb	UTSW	5	21757033	missense	probably benign
R7201:Pmpcb	UTSW	5	21737179	start codon destroyed	probably null	0.02
R7450:Pmpcb	UTSW	5	21746985	missense	possibly damaging	0.46
R7764:Pmpcb	UTSW	5	21743452	missense	probably damaging	1.00
R8247:Pmpcb	UTSW	5	21756854	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTAACTCCAACCGCCTGGG -3'
(R):5'- ACTGAGGTTGACGCTGTCTG -3'

Sequencing Primer
(F):5'- AACCGCCTGGGGATACATGTTC -3'
(R):5'- TCCATGGGCTGAGGATGGC -3'

Posted On

2017-12-04