Mutagenetix > Incidental Mutation

Incidental Mutation 'R6150:Arhgef1'

501877

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

044297-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R6150 (G1)

Quality Score

142.008

Status

Validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 24919357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117008 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]

AlphaFold

Q61210

Predicted Effect

probably benign
Transcript: ENSMUST00000047873

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098683

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117419

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117796

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126484

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129928

Predicted Effect

probably null
Transcript: ENSMUST00000132751

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132751

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145783

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

probably benign
Transcript: ENSMUST00000206508

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	A	G	11: 61,213,508	T74A	probably benign	Het
Art1	C	G	7: 102,107,087	R162G	probably benign	Het
Boll	T	A	1: 55,270,653	I280F	possibly damaging	Het
Cep44	T	C	8: 56,539,805	E258G	probably benign	Het
Cutc	T	A	19: 43,759,889	V75E	probably damaging	Het
Dtx1	T	C	5: 120,681,363	K590R	probably damaging	Het
Eps8	A	T	6: 137,517,174	D295E	probably damaging	Het
Erc2	C	A	14: 28,141,291	S491Y	probably damaging	Het
F2rl3	G	T	8: 72,762,738	A198S	probably benign	Het
Fam83b	G	A	9: 76,492,357	T488M	probably damaging	Het
Fitm2	A	G	2: 163,470,074	L73P	probably damaging	Het
Fxyd1	T	C	7: 31,054,803		probably null	Het
Gm17186	T	C	14: 51,680,726		noncoding transcript	Het
Hivep3	C	A	4: 119,734,077	S94*	probably null	Het
Ifna1	T	A	4: 88,850,112	M9K	probably null	Het
Igsf11	G	A	16: 39,023,349	E275K	probably damaging	Het
Itga1	G	A	13: 114,968,233	L1086F	probably benign	Het
Itgav	T	C	2: 83,776,436	S374P	probably benign	Het
Jmy	A	T	13: 93,441,133	N842K	probably benign	Het
Kcnh6	G	A	11: 106,020,731	V595M	possibly damaging	Het
Kif13b	T	A	14: 64,751,639	I823N	probably damaging	Het
Kif26b	T	C	1: 178,915,546	L1069P	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Kmt2b	G	T	7: 30,588,477		probably benign	Het
Map10	G	A	8: 125,671,589	D574N	probably damaging	Het
Mau2	A	T	8: 70,019,837	H565Q	probably benign	Het
Myb	A	G	10: 21,141,769	I641T	probably damaging	Het
Naaladl2	C	A	3: 24,552,050	G15V	probably null	Het
Olfr370	G	A	8: 83,541,153	C3Y	probably benign	Het
Olfr399	A	C	11: 74,054,319	S147A	probably benign	Het
Olfr800	A	G	10: 129,659,934	I43V	probably benign	Het
Olfr867	A	T	9: 20,054,874	N78K	probably benign	Het
Otog	A	G	7: 46,264,059	E772G	possibly damaging	Het
Pla2g4d	T	C	2: 120,269,564	D674G	probably damaging	Het
Pmpcb	A	G	5: 21,737,139		probably null	Het
Pomk	A	G	8: 25,983,256	V223A	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Serpina1e	A	G	12: 103,950,807	V201A	probably benign	Het
Six5	C	T	7: 19,097,521	P646S	probably benign	Het
Slc17a9	A	G	2: 180,737,628	I298V	probably benign	Het
Slc37a2	G	T	9: 37,238,347	T188K	probably damaging	Het
Slc6a11	T	A	6: 114,245,618	F525I	probably benign	Het
Slit2	A	T	5: 48,304,174	D1504V	probably damaging	Het
Srcap	T	A	7: 127,534,828	M907K	probably damaging	Het
Sspo	T	C	6: 48,486,379	L3746P	probably benign	Het
Supv3l1	A	T	10: 62,435,722	N376K	possibly damaging	Het
Tekt3	A	T	11: 63,094,657	T430S	possibly damaging	Het
Tex2	A	T	11: 106,567,080	V508D	probably benign	Het
Tmem184c	G	T	8: 77,596,440	Q598K	probably benign	Het
Ube2v1	G	A	2: 167,617,954	R42*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vangl1	T	C	3: 102,184,519	T84A	probably damaging	Het
Vgll3	T	A	16: 65,828,178		probably null	Het
Vmn1r61	T	A	7: 5,610,679	H212L	probably benign	Het
Vmn2r114	A	G	17: 23,291,295	V737A	probably benign	Het
Vmn2r35	A	T	7: 7,786,556	D727E	probably damaging	Het
Vps18	T	A	2: 119,297,592	Y965*	probably null	Het
Zfp521	A	T	18: 13,844,078	C1093S	probably damaging	Het
Zfp971	A	C	2: 178,033,454	H282P	probably benign	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4081:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5255:Arhgef1	UTSW	7	24925022	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5295:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8029:Arhgef1	UTSW	7	24919738	missense	probably damaging	1.00
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null
R8168:Arhgef1	UTSW	7	24925406	missense	probably benign	0.06
R8964:Arhgef1	UTSW	7	24923037	missense	probably damaging	1.00
R9114:Arhgef1	UTSW	7	24907879	missense	probably damaging	1.00
R9553:Arhgef1	UTSW	7	24919690	missense	probably damaging	1.00
R9676:Arhgef1	UTSW	7	24926076	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGCTATCAGGGCGTCTAGG -3'
(R):5'- CACTGTTAAGCTCCATCCTGG -3'

Sequencing Primer
(F):5'- TCTAGGGCGCTCAGAGAG -3'
(R):5'- AGTTACAAGCCCTCTGTGGC -3'

Posted On

2017-12-04