Incidental Mutation 'R6157:Smpd4'
ID501884
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 17641066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000163997] [ENSMUST00000163997] [ENSMUST00000165363] [ENSMUST00000170117] [ENSMUST00000170273] [ENSMUST00000170273] [ENSMUST00000170366] [ENSMUST00000170366] [ENSMUST00000170996] [ENSMUST00000170996] [ENSMUST00000231436] [ENSMUST00000231627] [ENSMUST00000231722] [ENSMUST00000231792] [ENSMUST00000232021] [ENSMUST00000232116] [ENSMUST00000232271]
Predicted Effect probably null
Transcript: ENSMUST00000006053
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090159
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163476
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163997
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163997
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165363
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000132279
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 46 2.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170273
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170273
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170366
SMART Domains Protein: ENSMUSP00000130990
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.1e-177 PFAM
Pfam:mit_SMPDase 286 643 1.8e-214 PFAM
Pfam:mit_SMPDase 642 696 8.6e-18 PFAM
transmembrane domain 697 719 N/A INTRINSIC
transmembrane domain 726 743 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170366
SMART Domains Protein: ENSMUSP00000130990
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.1e-177 PFAM
Pfam:mit_SMPDase 286 643 1.8e-214 PFAM
Pfam:mit_SMPDase 642 696 8.6e-18 PFAM
transmembrane domain 697 719 N/A INTRINSIC
transmembrane domain 726 743 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170996
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170996
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231378
Predicted Effect probably null
Transcript: ENSMUST00000231436
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect probably null
Transcript: ENSMUST00000231792
Predicted Effect probably null
Transcript: ENSMUST00000232021
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232270
Predicted Effect probably null
Transcript: ENSMUST00000232271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232468
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
R0197:Smpd4 UTSW 16 17641597 critical splice donor site probably null
R0549:Smpd4 UTSW 16 17639312 missense probably benign 0.15
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17640971 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
R7853:Smpd4 UTSW 16 17642741 missense probably damaging 1.00
R7936:Smpd4 UTSW 16 17642741 missense probably damaging 1.00
Z1176:Smpd4 UTSW 16 17619586 intron probably benign
Z1177:Smpd4 UTSW 16 17621441 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCTAGGTGAGCAGCTGTTC -3'
(R):5'- TAAGAGTGTCCACCCAGAGG -3'

Sequencing Primer
(F):5'- TGAGCAGCTGTTCCTGGAGC -3'
(R):5'- CCAGAGGGAAAAGGGACATC -3'
Posted On2017-12-04