Incidental Mutation 'R6158:Tmem87a'
ID501885
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Nametransmembrane protein 87A
SynonymsA930025J12Rik
MMRRC Submission 044305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6158 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120355312-120404113 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 120360103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729]
Predicted Effect probably null
Transcript: ENSMUST00000090042
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090046
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110729
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136410
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Ano3 A T 2: 110,665,875 Y845N probably damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Cpne8 A C 15: 90,571,988 S191A probably damaging Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mastl G T 2: 23,132,772 N646K possibly damaging Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo18b A T 5: 112,874,172 N451K probably benign Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Vwce C T 19: 10,644,221 R206C possibly damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
ANU18:Tmem87a UTSW 2 120380769 missense probably benign 0.01
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2396:Tmem87a UTSW 2 120404059 start codon destroyed probably null 0.02
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5642:Tmem87a UTSW 2 120403946 missense probably benign 0.00
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6261:Tmem87a UTSW 2 120404021 missense possibly damaging 0.57
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8124:Tmem87a UTSW 2 120392195 missense probably benign
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAATATCATGCAAGTGAGTAGTCC -3'
(R):5'- GGAGATGTTAGCCAAAGGTATTTG -3'

Sequencing Primer
(F):5'- CCTCAGTTTCCCACTGAAA -3'
(R):5'- GGATAACGAAAGGCTGCTA -3'
Posted On2017-12-04