Mutagenetix > Incidental Mutation

Incidental Mutation 'R6161:Ube2q1'

501892

Institutional Source

Beutler Lab

Gene Symbol

Ube2q1

Ensembl Gene

ENSMUSG00000042572

Gene Name

ubiquitin-conjugating enzyme E2Q family member 1

Synonyms

PRO3094, 2310012M18Rik, NICE-5, 1110002C01Rik

MMRRC Submission

044308-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R6161 (G1)

Quality Score

108.008

Status

Validated

Chromosome

Chromosomal Location

89773616-89784000 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 89781360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038356] [ENSMUST00000038356] [ENSMUST00000038356] [ENSMUST00000196726] [ENSMUST00000196726] [ENSMUST00000196726]

AlphaFold

Q7TSS2

Predicted Effect

probably null
Transcript: ENSMUST00000038356

SMART Domains

Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	2	39	N/A	INTRINSIC
Blast:RWD	43	156	1e-42	BLAST
low complexity region	183	202	N/A	INTRINSIC
Blast:UBCc	203	243	8e-13	BLAST
UBCc	254	415	2.8e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000038356

SMART Domains

Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	2	39	N/A	INTRINSIC
Blast:RWD	43	156	1e-42	BLAST
low complexity region	183	202	N/A	INTRINSIC
Blast:UBCc	203	243	8e-13	BLAST
UBCc	254	415	2.8e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000038356

SMART Domains

Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	2	39	N/A	INTRINSIC
Blast:RWD	43	156	1e-42	BLAST
low complexity region	183	202	N/A	INTRINSIC
Blast:UBCc	203	243	8e-13	BLAST
UBCc	254	415	2.8e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196726

SMART Domains

Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
Blast:UBCc	34	74	1e-13	BLAST
UBCc	85	246	2.8e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196726

SMART Domains

Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
Blast:UBCc	34	74	1e-13	BLAST
UBCc	85	246	2.8e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196726

SMART Domains

Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
Blast:UBCc	34	74	1e-13	BLAST
UBCc	85	246	2.8e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199427

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female-specific pleiotropic reproductive defects and partial embryonic lethality at implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Ube2q1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01299:Ube2q1	APN	3	89781374	missense	probably damaging	1.00
IGL02121:Ube2q1	APN	3	89780462	missense	possibly damaging	0.55
R0165:Ube2q1	UTSW	3	89776153	missense	probably damaging	1.00
R1680:Ube2q1	UTSW	3	89776176	missense	probably benign	0.01
R2072:Ube2q1	UTSW	3	89779571	critical splice donor site	probably null
R3548:Ube2q1	UTSW	3	89781076	missense	probably damaging	1.00
R4932:Ube2q1	UTSW	3	89779483	nonsense	probably null
R5472:Ube2q1	UTSW	3	89777241	missense	probably benign	0.00
R5902:Ube2q1	UTSW	3	89776180	nonsense	probably null
R7303:Ube2q1	UTSW	3	89776591	missense	possibly damaging	0.91
R8490:Ube2q1	UTSW	3	89774001	missense	probably benign
R8671:Ube2q1	UTSW	3	89776078	missense	probably damaging	1.00
R9558:Ube2q1	UTSW	3	89779459	missense	probably benign	0.01
RF022:Ube2q1	UTSW	3	89780893	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGCTGAGCTTTAACCCCATTG -3'
(R):5'- GACCCTAAAAGGCAGCTTTAGC -3'

Sequencing Primer
(F):5'- TTAATGGGGTGGGGGAACAAC -3'
(R):5'- CTTTAGCTGGCTGGTGGC -3'

Posted On

2017-12-04