Incidental Mutation 'R6164:Sele'
ID501895
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Nameselectin, endothelial cell
SynonymsCD62E, E-selectin, Elam
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164048234-164057677 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 164051817 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
Predicted Effect probably null
Transcript: ENSMUST00000027874
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 164051834 missense probably damaging 1.00
IGL02097:Sele APN 1 164053093 missense probably benign 0.02
IGL02243:Sele APN 1 164052968 missense probably benign 0.01
IGL02688:Sele APN 1 164050130 missense probably damaging 1.00
IGL03022:Sele APN 1 164054679 missense probably benign 0.01
R0433:Sele UTSW 1 164049244 missense possibly damaging 0.74
R0487:Sele UTSW 1 164053615 nonsense probably null
R0678:Sele UTSW 1 164054729 critical splice donor site probably null
R1295:Sele UTSW 1 164050810 missense probably damaging 1.00
R1296:Sele UTSW 1 164050810 missense probably damaging 1.00
R1532:Sele UTSW 1 164053851 missense probably benign 0.29
R1730:Sele UTSW 1 164054623 missense probably benign
R2102:Sele UTSW 1 164053826 missense probably damaging 1.00
R2384:Sele UTSW 1 164050775 missense probably benign 0.00
R3001:Sele UTSW 1 164053571 missense probably damaging 1.00
R3002:Sele UTSW 1 164053571 missense probably damaging 1.00
R5851:Sele UTSW 1 164049574 missense probably benign 0.06
R6239:Sele UTSW 1 164050808 missense probably damaging 0.98
R6406:Sele UTSW 1 164050743 missense probably damaging 1.00
R6411:Sele UTSW 1 164049415 missense probably benign 0.03
R6731:Sele UTSW 1 164053673 missense probably damaging 1.00
R6851:Sele UTSW 1 164053952 missense probably damaging 1.00
R7291:Sele UTSW 1 164053868 missense possibly damaging 0.89
R7328:Sele UTSW 1 164049275 missense probably benign 0.23
R7366:Sele UTSW 1 164048719 missense probably benign 0.00
R7393:Sele UTSW 1 164053923 missense probably benign 0.05
R7431:Sele UTSW 1 164051620 missense probably damaging 0.99
R7603:Sele UTSW 1 164049515 missense probably damaging 1.00
R7803:Sele UTSW 1 164050694 missense possibly damaging 0.88
R7807:Sele UTSW 1 164053893 missense probably benign 0.05
R8323:Sele UTSW 1 164051638 missense possibly damaging 0.59
X0005:Sele UTSW 1 164049343 missense probably damaging 1.00
X0021:Sele UTSW 1 164053611 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACATGCACGTTTGACTGTGTG -3'
(R):5'- TACTCACCTTTGCAGACTGGG -3'

Sequencing Primer
(F):5'- CTGTGTGGAAGGGTACAGGC -3'
(R):5'- CTCACCTTTGCAGACTGGGATTTG -3'
Posted On2017-12-04