Incidental Mutation 'R5752:Sp110'
ID501909
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R5752 (G1)
Quality Score23
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to C at 85577202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect unknown
Transcript: ENSMUST00000178024
AA Change: E109D
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127
AA Change: E109D

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm6768 A G 12: 119,262,614 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Olfr521 T C 7: 99,767,948 I262T probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Tas2r134 A G 2: 51,627,868 R120G probably damaging Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttc41 C T 10: 86,758,346 T881I probably benign Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCGTGAGCGTGTACCACAG -3'
(R):5'- ATACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- ACTCCCAGAATAATCTCACTTGTC -3'
Posted On2017-12-11