Mutagenetix > Incidental Mutation

Incidental Mutation 'R5752:Atrn'

501910

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

043357-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5752 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to T at 130906544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781] [ENSMUST00000146975]

AlphaFold

Q9WU60

Predicted Effect

probably benign
Transcript: ENSMUST00000028781

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133766

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135110

Predicted Effect

probably benign
Transcript: ENSMUST00000146975

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156982

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,743,202	Y268C	probably damaging	Het
A330017A19Rik	C	A	17: 46,890,040		probably benign	Het
Aldh1l2	C	A	10: 83,520,380	G49C	probably damaging	Het
Arhgap26	G	A	18: 39,286,672	E11K	probably damaging	Het
Asns	C	T	6: 7,689,365	G46S	probably damaging	Het
C77080	GGTG	GGTGTG	4: 129,223,980		probably null	Het
Cep126	A	C	9: 8,120,745	Y92*	probably null	Het
Cfap69	T	C	5: 5,589,204	T567A	probably damaging	Het
Clgn	T	A	8: 83,397,041	Y61N	probably damaging	Het
Col28a1	T	G	6: 8,015,025	K793N	possibly damaging	Het
Cxcl9	C	A	5: 92,323,856	M108I	probably benign	Het
Cyp4f37	A	T	17: 32,631,332	I318F	probably damaging	Het
Daam1	T	C	12: 71,946,546	M363T	unknown	Het
Dnajc13	A	C	9: 104,192,774		probably null	Het
Entpd2	G	A	2: 25,399,769		probably benign	Het
F3	T	A	3: 121,732,404	N205K	probably damaging	Het
Fat2	A	T	11: 55,289,237	F1426Y	possibly damaging	Het
Galnt6	A	T	15: 100,704,126	F267I	probably damaging	Het
Gm1322	G	A	2: 67,184,635		noncoding transcript	Het
Gm6768	A	G	12: 119,262,614		noncoding transcript	Het
Gm960	C	A	19: 4,626,020	A695S	probably benign	Het
Hdgfl3	A	C	7: 81,899,703	S143A	possibly damaging	Het
Ints7	T	A	1: 191,575,893	D12E	probably benign	Het
Kank3	A	G	17: 33,818,063	T114A	probably benign	Het
Lrp1b	A	G	2: 41,295,612	Y1364H	probably damaging	Het
Mef2b	A	G	8: 70,165,617	T116A	possibly damaging	Het
Megf8	C	T	7: 25,355,114	T1885I	probably damaging	Het
Mrps11	A	G	7: 78,783,595	K30E	probably benign	Het
Naca	T	A	10: 128,041,928		probably benign	Het
Olfr521	T	C	7: 99,767,948	I262T	probably benign	Het
Paip2b	C	T	6: 83,831,270		probably null	Het
Plcb2	G	T	2: 118,711,051		probably benign	Het
Plcd4	A	G	1: 74,547,972		probably null	Het
Pnpla8	A	G	12: 44,282,887	N74S	probably benign	Het
Pot1b	A	T	17: 55,687,834	I276N	probably damaging	Het
Qprt	C	T	7: 127,109,244	G5D	probably benign	Het
Rab11fip1	T	C	8: 27,156,586	N154S	probably damaging	Het
Rin3	G	A	12: 102,313,119		probably benign	Het
Sdf4	C	T	4: 155,996,304	P37S	probably damaging	Het
Selp	A	T	1: 164,137,242	D491V	probably damaging	Het
Sh3gl3	A	G	7: 82,174,948		probably benign	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tas2r134	A	G	2: 51,627,868	R120G	probably damaging	Het
Tgfbr3	T	C	5: 107,139,807	R509G	probably benign	Het
Tle3	T	A	9: 61,407,471	Y231N	probably damaging	Het
Ttc41	C	T	10: 86,758,346	T881I	probably benign	Het
Ttll8	T	C	15: 88,932,728	Y271C	probably benign	Het
Ttn	A	T	2: 76,947,984	I1307K	possibly damaging	Het
Ube2k	A	G	5: 65,566,068	D48G	probably damaging	Het
Vcan	T	C	13: 89,679,950	T3126A	probably damaging	Het
Vps13d	T	C	4: 145,148,970	T1656A	probably benign	Het
Zzz3	C	A	3: 152,452,122	S777R	possibly damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTTCATCCGCGCTAAGACC -3'
(R):5'- GATTTCAAGCCCTGCACCTG -3'

Sequencing Primer
(F):5'- TAAGACCCTGGCATTGAGC -3'
(R):5'- CTTGGGCCTGGAACATCAG -3'

Posted On

2017-12-11