Incidental Mutation 'R5748:Tcfl5'
ID501918
Institutional Source Beutler Lab
Gene Symbol Tcfl5
Ensembl Gene ENSMUSG00000038932
Gene Nametranscription factor-like 5 (basic helix-loop-helix)
SynonymsFiglb, FIG beta
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5748 (G1)
Quality Score44
Status Validated
Chromosome2
Chromosomal Location180621956-180642708 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 180642257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037877] [ENSMUST00000161425]
Predicted Effect silent
Transcript: ENSMUST00000037877
SMART Domains Protein: ENSMUSP00000040611
Gene: ENSMUSG00000038932

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 76 110 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 185 198 N/A INTRINSIC
low complexity region 355 373 N/A INTRINSIC
HLH 395 445 2.13e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131881
Predicted Effect silent
Transcript: ENSMUST00000161425
SMART Domains Protein: ENSMUSP00000125945
Gene: ENSMUSG00000038932

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 76 110 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 185 198 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Tcfl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Tcfl5 UTSW 2 180638626 missense possibly damaging 0.94
R1238:Tcfl5 UTSW 2 180622647 missense probably benign 0.29
R6679:Tcfl5 UTSW 2 180635262 missense probably damaging 1.00
R6694:Tcfl5 UTSW 2 180622654 missense probably damaging 1.00
R7293:Tcfl5 UTSW 2 180642165 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACACCAGCTCTGCAATCAGG -3'
(R):5'- AGCTGCAGCACATCCTCTAC -3'

Sequencing Primer
(F):5'- ATACTGTTGAAGCGGTCCTCCAG -3'
(R):5'- ATCCTCTACTCGCACATGGAGG -3'
Posted On2017-12-20