Incidental Mutation 'R5817:Cntn2'
ID501950
Institutional Source Beutler Lab
Gene Symbol Cntn2
Ensembl Gene ENSMUSG00000053024
Gene Namecontactin 2
Synonymsaxonin, Tax, TAG-1, D130012K04Rik
MMRRC Submission 043397-MU
Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5817 (G1)
Quality Score76
Status Validated
Chromosome1
Chromosomal Location132509427-132543256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132518748 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 784 (T784I)
Ref Sequence ENSEMBL: ENSMUSP00000083707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086521]
Predicted Effect probably benign
Transcript: ENSMUST00000086521
AA Change: T784I

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: T784I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect unknown
Transcript: ENSMUST00000188065
AA Change: T287I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188143
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Cntn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Cntn2 APN 1 132521884 splice site probably benign
IGL01137:Cntn2 APN 1 132521297 splice site probably benign
IGL01339:Cntn2 APN 1 132518905 splice site probably null
IGL01369:Cntn2 APN 1 132516105 missense probably benign
IGL01572:Cntn2 APN 1 132528171 missense probably damaging 1.00
IGL02389:Cntn2 APN 1 132525321 missense probably damaging 0.99
IGL02473:Cntn2 APN 1 132518331 missense probably benign
IGL02550:Cntn2 APN 1 132529063 missense probably null 0.03
IGL02608:Cntn2 APN 1 132525916 missense possibly damaging 0.87
IGL02755:Cntn2 APN 1 132529302 missense probably benign 0.43
IGL02850:Cntn2 APN 1 132518376 missense probably benign 0.00
IGL02887:Cntn2 APN 1 132516570 missense probably damaging 0.96
IGL03060:Cntn2 APN 1 132528940 missense probably benign 0.03
IGL03224:Cntn2 APN 1 132523042 missense probably damaging 1.00
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0270:Cntn2 UTSW 1 132521724 missense probably damaging 1.00
R0739:Cntn2 UTSW 1 132529012 missense probably damaging 1.00
R0849:Cntn2 UTSW 1 132522386 missense probably benign 0.09
R0903:Cntn2 UTSW 1 132533684 small deletion probably benign
R1463:Cntn2 UTSW 1 132521137 critical splice donor site probably null
R1512:Cntn2 UTSW 1 132523692 missense probably damaging 0.99
R1535:Cntn2 UTSW 1 132525384 missense probably benign 0.26
R1686:Cntn2 UTSW 1 132526311 missense possibly damaging 0.78
R1696:Cntn2 UTSW 1 132521279 missense probably damaging 0.96
R1708:Cntn2 UTSW 1 132519198 missense probably damaging 0.96
R2251:Cntn2 UTSW 1 132525321 missense probably damaging 0.99
R2315:Cntn2 UTSW 1 132522997 missense probably benign 0.00
R2395:Cntn2 UTSW 1 132526372 missense probably benign
R3617:Cntn2 UTSW 1 132528623 missense probably benign 0.16
R3883:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R3884:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R4060:Cntn2 UTSW 1 132525896 missense probably damaging 0.99
R4289:Cntn2 UTSW 1 132527743 missense probably benign 0.01
R4710:Cntn2 UTSW 1 132528225 missense possibly damaging 0.84
R4921:Cntn2 UTSW 1 132516032 missense possibly damaging 0.49
R5121:Cntn2 UTSW 1 132517060 nonsense probably null
R5288:Cntn2 UTSW 1 132523677 missense probably benign 0.18
R5360:Cntn2 UTSW 1 132518857 missense probably damaging 0.97
R5787:Cntn2 UTSW 1 132523059 missense probably damaging 1.00
R5930:Cntn2 UTSW 1 132523432 missense probably damaging 1.00
R6053:Cntn2 UTSW 1 132518352 missense probably benign 0.18
R7189:Cntn2 UTSW 1 132517086 missense probably damaging 1.00
R7352:Cntn2 UTSW 1 132522399 missense probably benign 0.02
R7562:Cntn2 UTSW 1 132526317 missense possibly damaging 0.67
R7689:Cntn2 UTSW 1 132516144 missense probably benign 0.00
R7764:Cntn2 UTSW 1 132522363 missense probably benign 0.21
R8080:Cntn2 UTSW 1 132521798 missense probably damaging 1.00
R8344:Cntn2 UTSW 1 132521774 missense probably damaging 1.00
X0018:Cntn2 UTSW 1 132533684 small deletion probably benign
Z1176:Cntn2 UTSW 1 132527788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTGCGCAGGATGAAGCC -3'
(R):5'- TCACTCCTCTGGGTGAAGACTG -3'

Sequencing Primer
(F):5'- AAGTGCACCCCAGGCTTTC -3'
(R):5'- ATGGGTAGGGACACACACCC -3'
Posted On2018-01-26