Incidental Mutation 'R5869:Coro1c'
ID501955
Institutional Source Beutler Lab
Gene Symbol Coro1c
Ensembl Gene ENSMUSG00000004530
Gene Namecoronin, actin binding protein 1C
Synonymscoronin 3
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5869 (G1)
Quality Score47
Status Validated
Chromosome5
Chromosomal Location113842436-113908758 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 113850846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004646] [ENSMUST00000164980]
Predicted Effect probably benign
Transcript: ENSMUST00000004646
SMART Domains Protein: ENSMUSP00000004646
Gene: ENSMUSG00000004530

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
WD40 119 159 1.09e-5 SMART
WD40 162 202 3.09e-5 SMART
DUF1900 256 390 4.5e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163995
Predicted Effect probably benign
Transcript: ENSMUST00000164980
SMART Domains Protein: ENSMUSP00000129314
Gene: ENSMUSG00000004530

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
Pfam:WD40 120 149 8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172016
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Coro1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Coro1c APN 5 113849614 missense probably benign 0.07
IGL01138:Coro1c APN 5 113852161 splice site probably benign
IGL01474:Coro1c APN 5 113882155 splice site probably benign
IGL02075:Coro1c APN 5 113844393 missense probably damaging 1.00
IGL02106:Coro1c APN 5 113852273 missense probably benign 0.01
IGL02831:Coro1c APN 5 113844408 missense probably benign
R0254:Coro1c UTSW 5 113845252 missense probably benign 0.09
R0975:Coro1c UTSW 5 113882121 missense probably damaging 1.00
R1835:Coro1c UTSW 5 113848543 missense probably benign 0.10
R2944:Coro1c UTSW 5 113850800 missense probably damaging 1.00
R5210:Coro1c UTSW 5 113845306 missense probably damaging 1.00
R5354:Coro1c UTSW 5 113846165 missense possibly damaging 0.94
R5379:Coro1c UTSW 5 113845382 missense probably damaging 1.00
R5414:Coro1c UTSW 5 113848546 missense possibly damaging 0.55
R5891:Coro1c UTSW 5 113850811 missense probably damaging 0.98
R7037:Coro1c UTSW 5 113845396 missense possibly damaging 0.60
R7116:Coro1c UTSW 5 113852206 nonsense probably null
R7536:Coro1c UTSW 5 113845289 missense probably damaging 1.00
X0018:Coro1c UTSW 5 113848594 missense probably benign 0.13
Z1088:Coro1c UTSW 5 113850649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGGTCAATGACTCTCACTTTC -3'
(R):5'- TCCATTAGTCCAGCTGACCC -3'

Sequencing Primer
(F):5'- GGGTCAATGACTCTCACTTTCTTGTC -3'
(R):5'- CCCAGGGGACTTCTGTTGTG -3'
Posted On2018-01-31