Incidental Mutation 'R5869:Cnot3'
ID501956
Institutional Source Beutler Lab
Gene Symbol Cnot3
Ensembl Gene ENSMUSG00000035632
Gene NameCCR4-NOT transcription complex, subunit 3
SynonymsA930039N10Rik
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5869 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location3645268-3661109 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 3644930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008517] [ENSMUST00000038913] [ENSMUST00000108636] [ENSMUST00000179769] [ENSMUST00000206287]
Predicted Effect probably benign
Transcript: ENSMUST00000008517
SMART Domains Protein: ENSMUSP00000008517
Gene: ENSMUSG00000008373

DomainStartEndE-ValueType
low complexity region 4 38 N/A INTRINSIC
NOSIC 92 144 2.58e-22 SMART
low complexity region 287 298 N/A INTRINSIC
Pfam:Prp31_C 337 465 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038913
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108636
SMART Domains Protein: ENSMUSP00000104276
Gene: ENSMUSG00000008373

DomainStartEndE-ValueType
low complexity region 4 38 N/A INTRINSIC
NOSIC 92 144 2.58e-22 SMART
Pfam:Nop 186 328 4.9e-46 PFAM
Pfam:Prp31_C 330 459 4.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148641
Predicted Effect probably benign
Transcript: ENSMUST00000179769
SMART Domains Protein: ENSMUSP00000136031
Gene: ENSMUSG00000008373

DomainStartEndE-ValueType
low complexity region 4 38 N/A INTRINSIC
NOSIC 92 144 2.58e-22 SMART
Pfam:Nop 186 328 4.9e-46 PFAM
Pfam:Prp31_C 330 459 4.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206075
Predicted Effect probably benign
Transcript: ENSMUST00000206287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206440
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show defective outgrowth of the inner cell mass and complete embryonic lethality at implantation. Heterozygotes exhibit decreased cardiac muscle contractility and develop severe cardiomyopathy leading to heart failure in response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Cnot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cnot3 APN 7 3650855 missense probably damaging 1.00
IGL02231:Cnot3 APN 7 3658210 missense probably benign 0.00
IGL02476:Cnot3 APN 7 3658068 missense probably benign 0.01
IGL03102:Cnot3 APN 7 3656156 nonsense probably null
IGL03181:Cnot3 APN 7 3653248 missense probably damaging 1.00
secondary UTSW 7 3651919 missense probably damaging 1.00
R4531:Cnot3 UTSW 7 3658074 missense probably benign
R4564:Cnot3 UTSW 7 3653258 missense probably damaging 1.00
R5071:Cnot3 UTSW 7 3650861 missense probably damaging 1.00
R5649:Cnot3 UTSW 7 3658083 missense probably benign 0.08
R6120:Cnot3 UTSW 7 3645336 unclassified probably null
R6759:Cnot3 UTSW 7 3651919 missense probably damaging 1.00
R7305:Cnot3 UTSW 7 3645480 start gained probably benign
R7369:Cnot3 UTSW 7 3653331 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTCCGTCTCCCACTAGATAAGC -3'
(R):5'- AGGCCAACCTCTTCATTATGATTG -3'

Sequencing Primer
(F):5'- GATAAGCTTCCTTTAACACTCACACG -3'
(R):5'- AACCTCTTCATTATGATTGGCTGATC -3'
Posted On2018-01-31