Incidental Mutation 'R5869:Slc5a5'
ID501957
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Namesolute carrier family 5 (sodium iodide symporter), member 5
SynonymsNIS
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5869 (G1)
Quality Score32
Status Validated
Chromosome8
Chromosomal Location70882889-70892757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70892330 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 111 (R111L)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220] [ENSMUST00000212129] [ENSMUST00000212378] [ENSMUST00000212494] [ENSMUST00000212709] [ENSMUST00000212796] [ENSMUST00000213053]
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: R111L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: R111L

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054220
SMART Domains Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 7 130 1.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212019
Predicted Effect probably benign
Transcript: ENSMUST00000212129
Predicted Effect probably benign
Transcript: ENSMUST00000212378
Predicted Effect probably benign
Transcript: ENSMUST00000212494
Predicted Effect probably benign
Transcript: ENSMUST00000212709
Predicted Effect probably benign
Transcript: ENSMUST00000212796
Predicted Effect probably benign
Transcript: ENSMUST00000213053
Meta Mutation Damage Score 0.4917 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 intron probably null
R2111:Slc5a5 UTSW 8 70889751 intron probably null
R2112:Slc5a5 UTSW 8 70889751 intron probably null
R2201:Slc5a5 UTSW 8 70892458 missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5161:Slc5a5 UTSW 8 70888848 missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 70887755 missense probably benign 0.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R6268:Slc5a5 UTSW 8 70888620 missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 70888538 missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 70889603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCGTTTGAACTCTGTCGG -3'
(R):5'- GTTACCTGTCTCCATGGAGG -3'

Sequencing Primer
(F):5'- TTGAACTCTGTCGGGCGCC -3'
(R):5'- TGTTCGCGACCATGCTG -3'
Posted On2018-01-31