Incidental Mutation 'R5869:Pitx3'
ID 501959
Institutional Source Beutler Lab
Gene Symbol Pitx3
Ensembl Gene ENSMUSG00000025229
Gene Name paired-like homeodomain transcription factor 3
Synonyms Ptx3
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5869 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 46135685-46148326 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 46137296 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026259] [ENSMUST00000043739] [ENSMUST00000172971]
AlphaFold O35160
Predicted Effect probably benign
Transcript: ENSMUST00000026259
SMART Domains Protein: ENSMUSP00000026259
Gene: ENSMUSG00000025229

DomainStartEndE-ValueType
HOX 62 124 3.48e-26 SMART
low complexity region 157 174 N/A INTRINSIC
low complexity region 189 236 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
Pfam:OAR 258 276 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043739
SMART Domains Protein: ENSMUSP00000036357
Gene: ENSMUSG00000038754

DomainStartEndE-ValueType
Pfam:ELO 30 267 2.9e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172971
SMART Domains Protein: ENSMUSP00000134563
Gene: ENSMUSG00000025229

DomainStartEndE-ValueType
Pfam:Homeobox 63 91 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172980
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family act as transcription factors. This protein is involved in lens formation during eye development. Mutations of this gene have been associated with anterior segment mesenchymal dysgenesis and congenital cataracts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of ocular development and loss of a subset of midbrain dopaminergic neurons. Observed phenotypes may include growth abnormalities, alterations in liver, lung, and bone function, and sex-specific neurobehavioral anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Pitx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:Pitx3 UTSW 19 46137473 missense probably benign 0.34
R2046:Pitx3 UTSW 19 46137179 missense possibly damaging 0.72
R2190:Pitx3 UTSW 19 46137047 missense probably damaging 0.98
R3547:Pitx3 UTSW 19 46136109 missense possibly damaging 0.93
R4666:Pitx3 UTSW 19 46137101 missense possibly damaging 0.93
R7427:Pitx3 UTSW 19 46137424 missense possibly damaging 0.85
R8970:Pitx3 UTSW 19 46137101 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAGCGATTCCTCTGGAAGGTGG -3'
(R):5'- ACTAGAGACCTCCCTCCATG -3'

Sequencing Primer
(F):5'- TCTGGAAGGTGGCCTCCAG -3'
(R):5'- CTCCCTCCATGGAGTTTGGG -3'
Posted On 2018-01-31