Incidental Mutation 'R5845:Plxna4'
ID501961
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 044063-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.620) question?
Stock #R5845 (G1)
Quality Score56
Status Validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32237776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 590 (V590D)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: V590D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: V590D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Meta Mutation Damage Score 0.8533 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTACCCAGGCACAATG -3'
(R):5'- CATTCCGATCCAAGTAGGTTTCTTG -3'

Sequencing Primer
(F):5'- TGAAAAGTCTGCCACCCAACTTTG -3'
(R):5'- GCACTCTTGTAACAAGCTGG -3'
Posted On2018-01-31