Incidental Mutation 'R5877:Caskin1'
ID501976
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene NameCASK interacting protein 1
SynonymsC630036E02Rik, 3300002N10Rik
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5877 (G1)
Quality Score68
Status Validated
Chromosome17
Chromosomal Location24488783-24508905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24505265 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1009 (M1009T)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176353] [ENSMUST00000176652] [ENSMUST00000176668]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024958
AA Change: M1009T

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: M1009T

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070777
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088464
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175732
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176530
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Meta Mutation Damage Score 0.1646 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24503889 missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24499349 critical splice donor site probably null
IGL01120:Caskin1 APN 17 24505369 missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24504548 missense probably benign
IGL01622:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL01623:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL02120:Caskin1 APN 17 24500942 missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24502170 missense probably benign 0.06
IGL02898:Caskin1 APN 17 24502409 missense probably benign 0.00
IGL03353:Caskin1 APN 17 24499357 splice site probably benign
PIT4151001:Caskin1 UTSW 17 24502219 missense probably damaging 1.00
PIT4453001:Caskin1 UTSW 17 24499292 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24504622 missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24505400 missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24505694 missense probably damaging 1.00
R1035:Caskin1 UTSW 17 24505037 missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24505073 missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24504541 nonsense probably null
R1589:Caskin1 UTSW 17 24505478 unclassified probably null
R1651:Caskin1 UTSW 17 24502212 missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24500771 missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24506850 missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24496459 missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24496996 critical splice donor site probably null
R2158:Caskin1 UTSW 17 24505154 missense probably benign
R2402:Caskin1 UTSW 17 24503808 missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24489042 missense probably damaging 1.00
R3423:Caskin1 UTSW 17 24499565 missense probably damaging 0.98
R3800:Caskin1 UTSW 17 24501272 missense probably benign
R4108:Caskin1 UTSW 17 24502147 missense probably benign
R4419:Caskin1 UTSW 17 24504709 missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4511:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4552:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4638:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4642:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4644:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4824:Caskin1 UTSW 17 24501129 missense probably benign 0.01
R4882:Caskin1 UTSW 17 24504415 missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24504547 missense probably benign 0.06
R5841:Caskin1 UTSW 17 24496209 missense probably damaging 0.99
R5960:Caskin1 UTSW 17 24498895 missense probably benign 0.31
R5994:Caskin1 UTSW 17 24496961 missense probably damaging 0.98
R6022:Caskin1 UTSW 17 24496735 missense probably benign 0.37
R6209:Caskin1 UTSW 17 24507121 missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24507180 missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24496709 missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24504548 missense probably benign
R6873:Caskin1 UTSW 17 24504179 missense probably benign 0.31
R7079:Caskin1 UTSW 17 24498884 missense probably benign 0.31
R7156:Caskin1 UTSW 17 24500683 splice site probably null
R7385:Caskin1 UTSW 17 24503924 missense probably damaging 1.00
X0022:Caskin1 UTSW 17 24505166 missense probably benign 0.34
X0063:Caskin1 UTSW 17 24507182 missense probably damaging 1.00
Z1176:Caskin1 UTSW 17 24505038 missense probably damaging 1.00
Z1177:Caskin1 UTSW 17 24496687 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCAGTCCTTTGCTGTGCG -3'
(R):5'- CTCCATAAAATGACTCTGCTCTG -3'

Sequencing Primer
(F):5'- CTGTGCGGCCACGTAAGAAG -3'
(R):5'- TGACTGGGCCACTGAGTGTAC -3'
Posted On2018-02-08