Incidental Mutation 'R6027:P2ry6'
ID501983
Institutional Source Beutler Lab
Gene Symbol P2ry6
Ensembl Gene ENSMUSG00000048779
Gene Namepyrimidinergic receptor P2Y, G-protein coupled, 6
SynonymsP2Y6, 2010204J23Rik
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6027 (G1)
Quality Score42.0073
Status Validated
Chromosome7
Chromosomal Location100937630-100974649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100938508 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 215 (M215L)
Ref Sequence ENSEMBL: ENSMUSP00000055697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060174]
Predicted Effect probably benign
Transcript: ENSMUST00000060174
AA Change: M215L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055697
Gene: ENSMUSG00000048779
AA Change: M215L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 33 270 2.6e-6 PFAM
Pfam:7tm_1 43 301 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209196
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal macrophage, endothelial, and vascular smooth muscle response to UTP and UDP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in P2ry6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:P2ry6 APN 7 100938864 missense probably damaging 1.00
R0195:P2ry6 UTSW 7 100938697 missense probably damaging 1.00
R1669:P2ry6 UTSW 7 100938423 missense probably damaging 0.99
R1688:P2ry6 UTSW 7 100938384 missense probably damaging 1.00
R4607:P2ry6 UTSW 7 100938304 missense probably damaging 1.00
R4608:P2ry6 UTSW 7 100938304 missense probably damaging 1.00
R6320:P2ry6 UTSW 7 100938396 missense probably damaging 1.00
R6490:P2ry6 UTSW 7 100938373 missense probably damaging 1.00
R7582:P2ry6 UTSW 7 100938577 missense probably damaging 1.00
X0066:P2ry6 UTSW 7 100938981 missense probably benign 0.00
Z1177:P2ry6 UTSW 7 100938283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTAGGCAGCAGCGAAGG -3'
(R):5'- TCACCTGCATTAGCTTCCAG -3'

Sequencing Primer
(F):5'- AGCGAAGGTCTCCAGCACAG -3'
(R):5'- TTCCTGGCACAAGCGTG -3'
Posted On2018-02-08