Incidental Mutation 'R6027:Gan'
ID501984
Institutional Source Beutler Lab
Gene Symbol Gan
Ensembl Gene ENSMUSG00000052557
Gene Namegiant axonal neuropathy
Synonymsgigaxonin
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6027 (G1)
Quality Score50.0181
Status Validated
Chromosome8
Chromosomal Location117158135-117215997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117158295 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000070168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064488]
Predicted Effect probably damaging
Transcript: ENSMUST00000064488
AA Change: Y54C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070168
Gene: ENSMUSG00000052557
AA Change: Y54C

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162997
AA Change: Y53C
SMART Domains Protein: ENSMUSP00000124904
Gene: ENSMUSG00000052557
AA Change: Y53C

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Meta Mutation Damage Score 0.4528 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
PHENOTYPE: Null homozygotes display some muscular atrophy and motor neuron degeneration with the severity of these symptoms depending on genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Gan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Gan APN 8 117193324 missense probably damaging 0.98
IGL01132:Gan APN 8 117196444 splice site probably benign
IGL01622:Gan APN 8 117187178 missense probably damaging 1.00
IGL01623:Gan APN 8 117187178 missense probably damaging 1.00
IGL03093:Gan APN 8 117183575 missense probably benign
R1534:Gan UTSW 8 117187429 missense probably benign 0.04
R1795:Gan UTSW 8 117196460 missense possibly damaging 0.57
R2027:Gan UTSW 8 117187499 critical splice donor site probably null
R2967:Gan UTSW 8 117183526 missense probably damaging 0.98
R3906:Gan UTSW 8 117194134 missense probably damaging 1.00
R4735:Gan UTSW 8 117194231 missense probably damaging 0.98
R5985:Gan UTSW 8 117195818 missense possibly damaging 0.89
R7002:Gan UTSW 8 117195847 missense possibly damaging 0.89
R7133:Gan UTSW 8 117187230 nonsense probably null
X0023:Gan UTSW 8 117190384 missense probably benign 0.01
Z31818:Gan UTSW 8 117195797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCCAGAGCTTCACTC -3'
(R):5'- AGGTAAAACTTCTGCGGGG -3'

Sequencing Primer
(F):5'- AGCTTCACTCAGTCCGGG -3'
(R):5'- CGGCCTGTACACCGTGTTTG -3'
Posted On2018-02-08