Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Fkbp3'

501985

Institutional Source

Beutler Lab

Gene Symbol

Fkbp3

Ensembl Gene

ENSMUSG00000020949

Gene Name

FK506 binding protein 3

Synonyms

25kDa, FKBP25

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6027 (G1)

Quality Score

57.0073

Status

Validated

Chromosome

Chromosomal Location

65062424-65074007 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 65073918 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 2 (A2E)

Ref Sequence

ENSEMBL: ENSMUSP00000152766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000058889] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913] [ENSMUST00000222540]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021332
AA Change: A2E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949
AA Change: A2E

Domain	Start	End	E-Value	Type
PDB:2KFV\|A	1	73	2e-45	PDB
low complexity region	91	100	N/A	INTRINSIC
Pfam:FKBP_C	121	221	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000058889

SMART Domains

Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884

Domain	Start	End	E-Value	Type
DEXDc	75	275	5.6e-25	SMART
Blast:DEXDc	295	323	9e-6	BLAST
low complexity region	339	348	N/A	INTRINSIC
HELICc	475	566	5.64e-21	SMART
Pfam:FANCM-MHF_bd	657	770	8.5e-50	PFAM
low complexity region	850	866	N/A	INTRINSIC
low complexity region	974	987	N/A	INTRINSIC
low complexity region	1105	1120	N/A	INTRINSIC
low complexity region	1165	1178	N/A	INTRINSIC
PDB:4DAY\|C	1207	1238	1e-6	PDB
low complexity region	1489	1506	N/A	INTRINSIC
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	1669	1682	N/A	INTRINSIC
ERCC4	1780	1863	2.07e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220730
AA Change: A2E

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220957

Predicted Effect

probably benign
Transcript: ENSMUST00000220983

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221166
AA Change: A2E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221710

Predicted Effect

silent
Transcript: ENSMUST00000221913

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222467

Predicted Effect

probably benign
Transcript: ENSMUST00000222540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222684

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223401

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223519

Meta Mutation Damage Score

0.0714

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, as well as histone deacetylases, the transcription factor YY1, casein kinase II, and nucleolin. It has a higher affinity for rapamycin than for FK506 and thus may be an important target molecule for immunosuppression by rapamycin. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Fkbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02670:Fkbp3	APN	12	65069103	nonsense	probably null
R0632:Fkbp3	UTSW	12	65073918	missense	probably benign	0.03
R4407:Fkbp3	UTSW	12	65070004	missense	probably damaging	0.99
R5742:Fkbp3	UTSW	12	65070038	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TATGTAAGGCATCTCCGGGG -3'
(R):5'- CGAGTCAATCCGGTTTAGGAC -3'

Sequencing Primer
(F):5'- GGGGGTGAAGCTGCCCC -3'
(R):5'- TTTAGGACCATGGCGGCC -3'

Posted On

2018-02-08