Incidental Mutation 'R5802:Gm17535'
ID 501996
Institutional Source Beutler Lab
Gene Symbol Gm17535
Ensembl Gene ENSMUSG00000096736
Gene Name predicted gene, 17535
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R5802 (G1)
Quality Score 30
Status Validated
Chromosome 9
Chromosomal Location 3034599-3035805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 3035758 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Valine to Leucine at position 209 (V209L)
Ref Sequence ENSEMBL: ENSMUSP00000135988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099042] [ENSMUST00000099051] [ENSMUST00000099056] [ENSMUST00000155807] [ENSMUST00000177969] [ENSMUST00000178641] [ENSMUST00000179264] [ENSMUST00000179839]
AlphaFold J3KMR8
Predicted Effect probably benign
Transcript: ENSMUST00000099042
SMART Domains Protein: ENSMUSP00000096640
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 47 9.09e-8 PROSPERO
transmembrane domain 76 98 N/A INTRINSIC
internal_repeat_1 117 164 9.09e-8 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099056
SMART Domains Protein: ENSMUSP00000096655
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 50 9.96e-8 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 223 9.96e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000155807
SMART Domains Protein: ENSMUSP00000136448
Gene: ENSMUSG00000096201

DomainStartEndE-ValueType
internal_repeat_1 1 48 2.67e-7 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 2.67e-7 PROSPERO
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177969
SMART Domains Protein: ENSMUSP00000137129
Gene: ENSMUSG00000096201

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.44e-6 PROSPERO
transmembrane domain 69 91 N/A INTRINSIC
internal_repeat_1 117 185 2.44e-6 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178641
AA Change: V209L

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135988
Gene: ENSMUSG00000096736
AA Change: V209L

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.86e-5 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 185 1.86e-5 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179264
SMART Domains Protein: ENSMUSP00000137451
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 43 5.09e-6 PROSPERO
transmembrane domain 69 91 N/A INTRINSIC
internal_repeat_1 117 179 5.09e-6 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179839
SMART Domains Protein: ENSMUSP00000136837
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 46 1.07e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 182 1.07e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Gm17535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gm17535 APN 9 3,035,111 (GRCm39) missense probably benign
R0153:Gm17535 UTSW 9 3,035,786 (GRCm39) missense probably benign
R0646:Gm17535 UTSW 9 3,035,804 (GRCm39) missense probably null 0.86
R1286:Gm17535 UTSW 9 3,035,786 (GRCm39) missense probably benign
R1403:Gm17535 UTSW 9 3,035,804 (GRCm39) missense probably null 0.86
R1404:Gm17535 UTSW 9 3,035,804 (GRCm39) missense probably null 0.86
R1406:Gm17535 UTSW 9 3,035,804 (GRCm39) missense probably null 0.86
R1422:Gm17535 UTSW 9 3,035,804 (GRCm39) missense probably null 0.86
R4827:Gm17535 UTSW 9 3,035,786 (GRCm39) missense probably benign
R5039:Gm17535 UTSW 9 3,035,786 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTATATTCCAAGTCCTACATTGTGC -3'
(R):5'- CGTGAAATATGGCGAGGAAAACT -3'

Sequencing Primer
(F):5'- TCCATGTCCTACAGTGGAAATTTC -3'
(R):5'- ATGCACACTGTAGGACTTGG -3'
Posted On 2018-02-15