Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Tbx3'

501998

Institutional Source

Beutler Lab

Gene Symbol

Tbx3

Ensembl Gene

ENSMUSG00000018604

Gene Name

T-box 3

Synonyms

D5Ertd189e

MMRRC Submission

044170-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5990 (G1)

Quality Score

44.0073

Status

Validated

Chromosome

Chromosomal Location

119670669-119684724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119680529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 390 (T390A)

Ref Sequence

ENSEMBL: ENSMUSP00000112519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]

AlphaFold

P70324

Predicted Effect

probably benign
Transcript: ENSMUST00000018748
AA Change: T410A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: T410A

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	310	6.4e-125	SMART
Pfam:TBX	323	411	8.8e-29	PFAM
low complexity region	492	510	N/A	INTRINSIC
low complexity region	524	538	N/A	INTRINSIC
low complexity region	556	576	N/A	INTRINSIC
low complexity region	607	620	N/A	INTRINSIC
low complexity region	662	710	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079719
AA Change: T390A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: T390A

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121021
AA Change: T390A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: T390A

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154680

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Tbx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01960:Tbx3	APN	5	119682643	missense	probably benign	0.45
IGL02174:Tbx3	APN	5	119675584	nonsense	probably null
IGL02508:Tbx3	APN	5	119678812	missense	possibly damaging	0.48
IGL03035:Tbx3	APN	5	119683096	utr 3 prime	probably benign
R0047:Tbx3	UTSW	5	119680446	missense	probably damaging	0.99
R0184:Tbx3	UTSW	5	119675562	missense	probably damaging	1.00
R0365:Tbx3	UTSW	5	119675250	missense	possibly damaging	0.81
R1209:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R1956:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R2231:Tbx3	UTSW	5	119677524	missense	probably damaging	1.00
R4093:Tbx3	UTSW	5	119680748	missense	probably benign
R4400:Tbx3	UTSW	5	119680571	missense	probably damaging	0.99
R4578:Tbx3	UTSW	5	119682776	missense	probably damaging	0.99
R4693:Tbx3	UTSW	5	119677570	missense	possibly damaging	0.72
R4716:Tbx3	UTSW	5	119675670	missense	possibly damaging	0.94
R4804:Tbx3	UTSW	5	119680512	missense	possibly damaging	0.63
R5664:Tbx3	UTSW	5	119678731	missense	possibly damaging	0.48
R5724:Tbx3	UTSW	5	119675603	missense	possibly damaging	0.75
R6133:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R6180:Tbx3	UTSW	5	119674067	missense	probably damaging	1.00
R6429:Tbx3	UTSW	5	119674191	nonsense	probably null
R7154:Tbx3	UTSW	5	119672028	missense	possibly damaging	0.89
R7195:Tbx3	UTSW	5	119675583	missense	probably damaging	1.00
R7352:Tbx3	UTSW	5	119677560	missense	probably benign	0.00
R7921:Tbx3	UTSW	5	119680869	missense	possibly damaging	0.76
R7921:Tbx3	UTSW	5	119680870	missense	probably benign	0.01
R8050:Tbx3	UTSW	5	119683067	missense	probably benign	0.38
R8089:Tbx3	UTSW	5	119680569	missense	probably damaging	0.98
R8351:Tbx3	UTSW	5	119680776	missense	probably damaging	1.00
R8422:Tbx3	UTSW	5	119680516	missense	possibly damaging	0.94
R8885:Tbx3	UTSW	5	119680559	missense	probably benign
R8891:Tbx3	UTSW	5	119671918	start gained	probably benign
R8987:Tbx3	UTSW	5	119680821	missense	possibly damaging	0.78
R9240:Tbx3	UTSW	5	119680895	missense	probably benign
X0063:Tbx3	UTSW	5	119680881	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACGAGATTGACCATCCGTTTCC -3'
(R):5'- TGCCCGTTGAAGAACTGCTG -3'

Sequencing Primer
(F):5'- AGATTGACCATCCGTTTCCCTTGG -3'
(R):5'- TTGAAGAACTGCTGGCCCG -3'

Posted On

2018-02-15