Incidental Mutation 'R5980:Sfrp5'
ID502002
Institutional Source Beutler Lab
Gene Symbol Sfrp5
Ensembl Gene ENSMUSG00000018822
Gene Namesecreted frizzled-related sequence protein 5
SynonymsSARP3
MMRRC Submission 044162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5980 (G1)
Quality Score40.0076
Status Validated
Chromosome19
Chromosomal Location42197971-42202252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42201972 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 14 (L14M)
Ref Sequence ENSEMBL: ENSMUSP00000018966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018966]
Predicted Effect unknown
Transcript: ENSMUST00000018966
AA Change: L14M
SMART Domains Protein: ENSMUSP00000018966
Gene: ENSMUSG00000018822
AA Change: L14M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 49 164 6.28e-58 SMART
C345C 191 294 1e-17 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Sfrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Sfrp5 APN 19 42199029 missense probably benign 0.00
IGL03347:Sfrp5 APN 19 42198768 missense probably benign 0.00
R1686:Sfrp5 UTSW 19 42201704 missense possibly damaging 0.88
R1911:Sfrp5 UTSW 19 42198798 missense probably benign
R2005:Sfrp5 UTSW 19 42198836 missense probably benign 0.03
R3815:Sfrp5 UTSW 19 42198791 missense probably benign 0.06
R3930:Sfrp5 UTSW 19 42201818 missense probably damaging 1.00
R5829:Sfrp5 UTSW 19 42201656 missense probably damaging 1.00
R6351:Sfrp5 UTSW 19 42201824 missense possibly damaging 0.91
R6702:Sfrp5 UTSW 19 42201827 missense probably benign 0.02
R6764:Sfrp5 UTSW 19 42199799 missense probably benign 0.00
R6836:Sfrp5 UTSW 19 42201710 missense probably damaging 0.97
R6895:Sfrp5 UTSW 19 42199788 missense probably damaging 1.00
R7024:Sfrp5 UTSW 19 42201765 missense possibly damaging 0.56
R7543:Sfrp5 UTSW 19 42198863 missense possibly damaging 0.67
R8442:Sfrp5 UTSW 19 42198797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGACCTGGGTGTCTGAGTG -3'
(R):5'- GAAAGACTCAGGGTTCCTCC -3'

Sequencing Primer
(F):5'- TGTCTGAGTGGCAGCGC -3'
(R):5'- CTGCAGATTGGCTAGGGAAC -3'
Posted On2018-02-15