Incidental Mutation 'R5999:Cald1'
ID502005
Institutional Source Beutler Lab
Gene Symbol Cald1
Ensembl Gene ENSMUSG00000029761
Gene Namecaldesmon 1
Synonyms4833423D12Rik, C920027I18Rik
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5999 (G1)
Quality Score75.0075
Status Validated
Chromosome6
Chromosomal Location34598500-34775473 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 34746338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031775] [ENSMUST00000079391] [ENSMUST00000115021] [ENSMUST00000115026] [ENSMUST00000115027] [ENSMUST00000126181] [ENSMUST00000142512] [ENSMUST00000149009]
Predicted Effect probably benign
Transcript: ENSMUST00000031775
SMART Domains Protein: ENSMUSP00000031775
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 542 5.7e-256 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079391
SMART Domains Protein: ENSMUSP00000078362
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 522 4.3e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115021
SMART Domains Protein: ENSMUSP00000110673
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 518 7.5e-259 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115026
SMART Domains Protein: ENSMUSP00000110678
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 524 4.9e-259 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115027
AA Change: E313V
SMART Domains Protein: ENSMUSP00000110679
Gene: ENSMUSG00000029761
AA Change: E313V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 363 8.4e-34 PFAM
Pfam:Caldesmon 243 755 3.8e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123823
SMART Domains Protein: ENSMUSP00000117064
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 210 4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126181
SMART Domains Protein: ENSMUSP00000121911
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 138 7.6e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136907
AA Change: E119V
SMART Domains Protein: ENSMUSP00000121213
Gene: ENSMUSG00000029761
AA Change: E119V

DomainStartEndE-ValueType
Pfam:Caldesmon 50 354 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142512
SMART Domains Protein: ENSMUSP00000122926
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 253 9.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142716
SMART Domains Protein: ENSMUSP00000116247
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 274 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146685
Predicted Effect probably benign
Transcript: ENSMUST00000149009
SMART Domains Protein: ENSMUSP00000138368
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 507 2e-247 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154182
Meta Mutation Damage Score 0.2565 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Some homozygous mutant mice develop hernia and those that do, die within 5-7 hours after birth. Mice homozygous for a different targeted allele fail to develop. Mice heterozygous for this allele exhibit increased urinary bladder weight, smooth muscle bundles and non-voiding contractions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Cald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cald1 APN 6 34762261 missense possibly damaging 0.66
IGL01456:Cald1 APN 6 34764996 missense probably damaging 1.00
IGL01822:Cald1 APN 6 34753572 missense probably damaging 0.99
IGL01959:Cald1 APN 6 34753468 missense probably damaging 1.00
IGL02307:Cald1 APN 6 34753455 missense probably damaging 1.00
IGL03122:Cald1 APN 6 34765028 missense probably damaging 1.00
R0060:Cald1 UTSW 6 34715459 intron probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0701:Cald1 UTSW 6 34746173 frame shift probably null
R0776:Cald1 UTSW 6 34746173 frame shift probably null
R1053:Cald1 UTSW 6 34755642 missense probably damaging 1.00
R1696:Cald1 UTSW 6 34745711 missense probably damaging 1.00
R2025:Cald1 UTSW 6 34746173 frame shift probably null
R2157:Cald1 UTSW 6 34686041 missense possibly damaging 0.86
R2973:Cald1 UTSW 6 34757996 unclassified probably benign
R3839:Cald1 UTSW 6 34745765 missense probably damaging 1.00
R4116:Cald1 UTSW 6 34745719 missense probably damaging 1.00
R4674:Cald1 UTSW 6 34746173 frame shift probably null
R5140:Cald1 UTSW 6 34753580 missense probably damaging 1.00
R5254:Cald1 UTSW 6 34746416 intron probably benign
R5620:Cald1 UTSW 6 34762112 missense probably damaging 1.00
R5648:Cald1 UTSW 6 34762332 splice site probably null
R5651:Cald1 UTSW 6 34762320 missense probably damaging 0.98
R5783:Cald1 UTSW 6 34753533 missense possibly damaging 0.51
R5872:Cald1 UTSW 6 34771108 nonsense probably null
R6218:Cald1 UTSW 6 34747928 frame shift probably null
R6347:Cald1 UTSW 6 34765046 missense probably damaging 1.00
R6598:Cald1 UTSW 6 34746640 critical splice donor site probably null
R7120:Cald1 UTSW 6 34686076 critical splice donor site probably null
R7147:Cald1 UTSW 6 34746296 missense
R7385:Cald1 UTSW 6 34686065 missense probably damaging 0.99
R7516:Cald1 UTSW 6 34709557 start gained probably benign
R7841:Cald1 UTSW 6 34745761 missense unknown
R7924:Cald1 UTSW 6 34745761 missense unknown
X0064:Cald1 UTSW 6 34746205 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACATGGAGGAGATAGCCCGT -3'
(R):5'- CTGAAGTCTGTCGTCTGGGG -3'

Sequencing Primer
(F):5'- AAAAAGATGGGGGAGGAAGAG -3'
(R):5'- TGTCGTCTGGGGCCTCC -3'
Posted On2018-02-15