Incidental Mutation 'R6014:Ralgds'
ID502015
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
MMRRC Submission 044190-MU
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6014 (G1)
Quality Score71.0074
Status Validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28543661 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 219 (N219S)
Ref Sequence ENSEMBL: ENSMUSP00000109526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028170
AA Change: N176S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: N176S

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100241
AA Change: N231S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: N231S

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113893
AA Change: N219S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: N219S

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130281
Predicted Effect probably benign
Transcript: ENSMUST00000135803
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137215
AA Change: T78A
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821
AA Change: T78A

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146217
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7399:Ralgds UTSW 2 28543655 missense possibly damaging 0.95
R7446:Ralgds UTSW 2 28545889 missense probably damaging 0.99
R7560:Ralgds UTSW 2 28547595 missense probably damaging 1.00
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTAGTTACTTGGACAGCC -3'
(R):5'- CAAGATGGTATCCCAGACTCTG -3'

Sequencing Primer
(F):5'- ACTTGTGGGTGGAGGCACAC -3'
(R):5'- GGTGTACTACCTACTGGGCC -3'
Posted On2018-02-19