Incidental Mutation 'R6056:Tulp2'
ID 502026
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
MMRRC Submission 044223-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R6056 (G1)
Quality Score 56.0072
Status Validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation splice site (85 bp from exon)
DNA Base Change (assembly) T to A at 45139797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011526] [ENSMUST00000033096] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000211765] [ENSMUST00000210813]
AlphaFold P46686
Predicted Effect probably benign
Transcript: ENSMUST00000011526
SMART Domains Protein: ENSMUSP00000011526
Gene: ENSMUSG00000011382

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 3 124 2e-25 PFAM
low complexity region 307 320 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000033096
SMART Domains Protein: ENSMUSP00000033096
Gene: ENSMUSG00000030824

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:EF-hand_7 227 319 2.1e-9 PFAM
coiled coil region 340 407 N/A INTRINSIC
low complexity region 420 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210440
Predicted Effect probably null
Transcript: ENSMUST00000211765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000210701
Predicted Effect probably null
Transcript: ENSMUST00000210449
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,115 (GRCm39) W162R probably benign Het
4930438A08Rik C A 11: 58,184,464 (GRCm39) P394H probably damaging Het
Aggf1 C T 13: 95,508,123 (GRCm39) C81Y probably benign Het
Agxt2 A T 15: 10,378,963 (GRCm39) D188V probably damaging Het
Angpt2 T C 8: 18,748,132 (GRCm39) K376R probably benign Het
Anxa5 A G 3: 36,504,840 (GRCm39) S241P probably damaging Het
Aox3 A T 1: 58,209,018 (GRCm39) K850N probably damaging Het
Arid5a T C 1: 36,358,473 (GRCm39) M415T probably benign Het
Aspa T A 11: 73,199,578 (GRCm39) N233I probably damaging Het
Atp4b C T 8: 13,438,782 (GRCm39) R198Q probably damaging Het
Atp8b2 A T 3: 89,853,528 (GRCm39) V719E possibly damaging Het
Bltp2 C A 11: 78,162,210 (GRCm39) L691I possibly damaging Het
Cacna1s T G 1: 136,033,574 (GRCm39) V1017G probably damaging Het
Chrna4 G T 2: 180,671,235 (GRCm39) Q174K probably damaging Het
Chrnb1 A T 11: 69,677,765 (GRCm39) V329D probably damaging Het
Chst14 T C 2: 118,758,214 (GRCm39) L336P probably damaging Het
Clec2e T C 6: 129,077,772 (GRCm39) D22G probably benign Het
Csrnp2 A C 15: 100,380,263 (GRCm39) S343A probably benign Het
Dapl1 C A 2: 59,315,057 (GRCm39) A2E probably damaging Het
Dlec1 G T 9: 118,950,991 (GRCm39) R519L probably damaging Het
Dmgdh T A 13: 93,845,251 (GRCm39) F415I possibly damaging Het
Dmgdh T C 13: 93,888,834 (GRCm39) V824A probably damaging Het
Dnah11 T G 12: 117,892,191 (GRCm39) T3661P probably benign Het
Dnah3 A G 7: 119,629,254 (GRCm39) F1434L probably damaging Het
Dnajc11 C A 4: 152,062,583 (GRCm39) probably benign Het
Dot1l A G 10: 80,621,929 (GRCm39) E527G probably damaging Het
Drc7 T C 8: 95,801,679 (GRCm39) L680P probably damaging Het
Dysf T C 6: 84,083,844 (GRCm39) Y742H probably benign Het
Ece1 A G 4: 137,688,958 (GRCm39) Y665C probably damaging Het
Emc1 A G 4: 139,081,533 (GRCm39) K54E possibly damaging Het
Enoph1 C T 5: 100,215,760 (GRCm39) T247M probably damaging Het
Exoc2 T C 13: 31,084,812 (GRCm39) K383R probably benign Het
Fam227b A T 2: 125,962,972 (GRCm39) H181Q probably damaging Het
Fsip2 A T 2: 82,816,017 (GRCm39) M3917L probably benign Het
Gtf3a T A 5: 146,892,338 (GRCm39) probably benign Het
Hgfac T A 5: 35,198,973 (GRCm39) C11* probably null Het
Hmcn1 C A 1: 150,539,660 (GRCm39) A2944S probably damaging Het
Hps5 T A 7: 46,416,521 (GRCm39) Y947F probably benign Het
Ighv2-5 A T 12: 113,649,120 (GRCm39) I111K probably benign Het
Inpp5e A T 2: 26,297,860 (GRCm39) L247* probably null Het
Kbtbd11 T C 8: 15,077,577 (GRCm39) S59P probably benign Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kif1a T C 1: 92,952,370 (GRCm39) D1303G probably damaging Het
Kif7 A G 7: 79,363,842 (GRCm39) V22A possibly damaging Het
Lrit3 A T 3: 129,583,004 (GRCm39) C328S probably damaging Het
Lrrc37a G T 11: 103,388,484 (GRCm39) Q2314K unknown Het
LTO1 G T 7: 144,469,023 (GRCm39) V17L possibly damaging Het
Lurap1 G T 4: 115,994,599 (GRCm39) P211T possibly damaging Het
Mbd2 T A 18: 70,713,874 (GRCm39) N5K possibly damaging Het
Mbtps1 A C 8: 120,242,341 (GRCm39) L894V probably benign Het
Mefv G A 16: 3,525,906 (GRCm39) S787F possibly damaging Het
Miip T A 4: 147,946,792 (GRCm39) I289F probably damaging Het
Mogat2 T A 7: 98,872,720 (GRCm39) I155F possibly damaging Het
Mpp3 C A 11: 101,902,515 (GRCm39) probably null Het
Mrrf A G 2: 36,067,233 (GRCm39) K220E probably damaging Het
Mtmr6 C T 14: 60,535,619 (GRCm39) P485L probably damaging Het
Mtor G A 4: 148,621,892 (GRCm39) R1896K probably benign Het
Myh3 C T 11: 66,978,371 (GRCm39) P453S probably benign Het
Nebl A G 2: 17,455,045 (GRCm39) V112A probably benign Het
Nmnat2 G A 1: 152,950,480 (GRCm39) W55* probably null Het
Nprl3 A G 11: 32,217,432 (GRCm39) S37P probably damaging Het
Or4a73 T C 2: 89,421,445 (GRCm39) N5D possibly damaging Het
Pcdhga4 T G 18: 37,819,383 (GRCm39) S311A probably benign Het
Pcdhgb6 T C 18: 37,876,165 (GRCm39) V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg3 T C 7: 6,712,570 (GRCm39) E884G probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Phf12 A G 11: 77,900,341 (GRCm39) T146A probably benign Het
Polr3k C G 2: 181,506,281 (GRCm39) N10K probably damaging Het
Prickle4 C A 17: 48,001,135 (GRCm39) G144C probably damaging Het
Ptpn6 T C 6: 124,709,398 (GRCm39) Y25C probably damaging Het
Rad1 A G 15: 10,488,160 (GRCm39) I95V probably damaging Het
Rad23b A G 4: 55,382,540 (GRCm39) T248A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rcc2 T G 4: 140,444,335 (GRCm39) V342G possibly damaging Het
Rgs3 G T 4: 62,544,143 (GRCm39) R136L probably damaging Het
Scube2 A T 7: 109,432,220 (GRCm39) C399* probably null Het
Serpinb3d T C 1: 107,007,452 (GRCm39) Y178C probably damaging Het
Slc1a7 A G 4: 107,869,458 (GRCm39) T508A probably benign Het
Slc29a4 C T 5: 142,705,832 (GRCm39) R439C probably damaging Het
Sntg2 A G 12: 30,362,560 (GRCm39) I62T probably benign Het
Sowaha G A 11: 53,369,914 (GRCm39) P274L probably damaging Het
Sptan1 A G 2: 29,886,794 (GRCm39) N869S probably benign Het
Stx18 C A 5: 38,263,908 (GRCm39) A64D probably damaging Het
Stxbp5 A G 10: 9,646,430 (GRCm39) V94A probably benign Het
Sult1a1 T A 7: 126,275,624 (GRCm39) probably null Het
Susd1 G T 4: 59,379,687 (GRCm39) H313Q possibly damaging Het
Tdrd9 A T 12: 111,951,475 (GRCm39) K88N probably damaging Het
Tlr5 A C 1: 182,801,603 (GRCm39) R302S possibly damaging Het
Tnr C T 1: 159,714,479 (GRCm39) T786I probably damaging Het
Tprg1l A G 4: 154,244,552 (GRCm39) S148P probably damaging Het
Trpc4ap T A 2: 155,512,994 (GRCm39) N127I probably damaging Het
Uggt2 C T 14: 119,273,381 (GRCm39) probably null Het
Ulk4 T A 9: 121,102,021 (GRCm39) Y19F probably damaging Het
Upf1 T C 8: 70,785,687 (GRCm39) Y1053C probably damaging Het
Vars2 A T 17: 35,976,680 (GRCm39) H223Q probably benign Het
Vmn2r106 T A 17: 20,487,806 (GRCm39) probably null Het
Ythdc2 T A 18: 44,973,277 (GRCm39) F305I probably damaging Het
Zfp281 T C 1: 136,553,178 (GRCm39) F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 (GRCm39) C1087S probably damaging Het
Zfp335 A T 2: 164,737,018 (GRCm39) probably null Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0648:Tulp2 UTSW 7 45,169,210 (GRCm39) missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1345:Tulp2 UTSW 7 45,168,145 (GRCm39) missense probably benign 0.13
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45,168,187 (GRCm39) missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7676:Tulp2 UTSW 7 45,170,451 (GRCm39) missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGTTGTCTTCCATGTCC -3'
(R):5'- GCTTGAAAACCCTGCTTGTG -3'

Posted On 2018-02-19