Incidental Mutation 'R6056:Vmn2r106'
ID502029
Institutional Source Beutler Lab
Gene Symbol Vmn2r106
Ensembl Gene ENSMUSG00000091656
Gene Namevomeronasal 2, receptor 106
SynonymsEG224576
MMRRC Submission 044223-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20267547-20285430 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to A at 20267544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167464]
Predicted Effect probably null
Transcript: ENSMUST00000167464
SMART Domains Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 471 3.8e-37 PFAM
Pfam:NCD3G 514 567 5.7e-22 PFAM
Pfam:7tm_3 596 835 1.3e-49 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Vmn2r106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Vmn2r106 APN 17 20277575 missense possibly damaging 0.90
IGL01313:Vmn2r106 APN 17 20278389 missense probably damaging 0.99
IGL01419:Vmn2r106 APN 17 20279545 missense probably benign 0.06
IGL01574:Vmn2r106 APN 17 20268310 missense possibly damaging 0.94
IGL01796:Vmn2r106 APN 17 20268052 missense possibly damaging 0.79
IGL01893:Vmn2r106 APN 17 20277468 missense probably benign 0.06
IGL01895:Vmn2r106 APN 17 20278965 missense probably benign 0.02
IGL02378:Vmn2r106 APN 17 20277529 missense probably damaging 1.00
IGL02430:Vmn2r106 APN 17 20278896 missense probably benign 0.38
IGL02664:Vmn2r106 APN 17 20268082 missense possibly damaging 0.88
IGL03308:Vmn2r106 APN 17 20278523 nonsense probably null
IGL03384:Vmn2r106 APN 17 20268143 missense probably damaging 0.99
R0401:Vmn2r106 UTSW 17 20279019 missense possibly damaging 0.86
R0842:Vmn2r106 UTSW 17 20268203 missense probably damaging 1.00
R0964:Vmn2r106 UTSW 17 20267597 missense probably benign 0.00
R1235:Vmn2r106 UTSW 17 20279479 missense probably benign 0.00
R1709:Vmn2r106 UTSW 17 20279111 missense probably benign 0.12
R1712:Vmn2r106 UTSW 17 20278735 missense probably benign 0.01
R1770:Vmn2r106 UTSW 17 20268298 missense probably damaging 0.99
R2049:Vmn2r106 UTSW 17 20268304 missense possibly damaging 0.90
R2245:Vmn2r106 UTSW 17 20268161 missense probably benign 0.13
R2336:Vmn2r106 UTSW 17 20268208 missense probably benign 0.18
R2910:Vmn2r106 UTSW 17 20278684 missense probably damaging 1.00
R3025:Vmn2r106 UTSW 17 20278885 missense probably benign 0.00
R3944:Vmn2r106 UTSW 17 20267651 missense probably damaging 1.00
R4081:Vmn2r106 UTSW 17 20267556 nonsense probably null
R4153:Vmn2r106 UTSW 17 20267818 missense probably damaging 1.00
R4356:Vmn2r106 UTSW 17 20279648 missense probably benign 0.06
R4426:Vmn2r106 UTSW 17 20285379 missense probably benign 0.00
R4590:Vmn2r106 UTSW 17 20277466 missense probably damaging 0.99
R4661:Vmn2r106 UTSW 17 20267623 missense probably benign 0.10
R5106:Vmn2r106 UTSW 17 20279133 critical splice acceptor site probably null
R5341:Vmn2r106 UTSW 17 20277526 missense probably benign 0.00
R5509:Vmn2r106 UTSW 17 20278422 missense probably damaging 0.99
R5826:Vmn2r106 UTSW 17 20278871 missense probably benign
R5859:Vmn2r106 UTSW 17 20285321 missense possibly damaging 0.72
R5937:Vmn2r106 UTSW 17 20285405 nonsense probably null
R5972:Vmn2r106 UTSW 17 20278476 missense probably benign
R6108:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6114:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6115:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6132:Vmn2r106 UTSW 17 20268404 missense probably benign
R6208:Vmn2r106 UTSW 17 20268329 missense probably damaging 0.99
R6217:Vmn2r106 UTSW 17 20268239 missense probably benign 0.10
R6289:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6378:Vmn2r106 UTSW 17 20278405 missense probably benign 0.19
R6390:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6391:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6392:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6405:Vmn2r106 UTSW 17 20279099 missense probably benign 0.22
R6427:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6428:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6435:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6436:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6437:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6511:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6512:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6587:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6703:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6730:Vmn2r106 UTSW 17 20278834 missense possibly damaging 0.64
R6961:Vmn2r106 UTSW 17 20268384 nonsense probably null
R7054:Vmn2r106 UTSW 17 20278920 missense probably damaging 0.96
R7379:Vmn2r106 UTSW 17 20267775 missense possibly damaging 0.75
R7402:Vmn2r106 UTSW 17 20267621 missense probably damaging 0.99
R7497:Vmn2r106 UTSW 17 20267939 missense probably damaging 1.00
R7692:Vmn2r106 UTSW 17 20285228 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATTGTACAGTTACCATGCCAAC -3'
(R):5'- CATGGTGGCTATGGAAGTCTTC -3'

Posted On2018-02-19