Incidental Mutation 'R6062:Grb14'
ID502030
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Namegrowth factor receptor bound protein 14
Synonyms
MMRRC Submission 044227-MU
Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6062 (G1)
Quality Score56.0072
Status Validated
Chromosome2
Chromosomal Location64912476-65024987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65022620 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 9 (Q9K)
Ref Sequence ENSEMBL: ENSMUSP00000028252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028252
AA Change: Q9K

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: Q9K

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146807
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64914718 missense probably damaging 1.00
IGL02267:Grb14 APN 2 64953616 missense probably damaging 1.00
IGL02902:Grb14 APN 2 64938418 missense probably damaging 1.00
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64914727 nonsense probably null
R0681:Grb14 UTSW 2 64917287 missense probably damaging 1.00
R1215:Grb14 UTSW 2 64917264 missense probably benign 0.01
R1781:Grb14 UTSW 2 64975555 critical splice donor site probably null
R1932:Grb14 UTSW 2 64912802 missense probably damaging 1.00
R2034:Grb14 UTSW 2 64923529 splice site probably benign
R4405:Grb14 UTSW 2 64953622 missense probably damaging 1.00
R4505:Grb14 UTSW 2 65022568 missense probably damaging 0.97
R4580:Grb14 UTSW 2 64953603 missense probably benign 0.29
R5216:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5367:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5369:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5382:Grb14 UTSW 2 64914734 missense probably damaging 1.00
R5457:Grb14 UTSW 2 64917098 missense probably damaging 1.00
R5816:Grb14 UTSW 2 64917284 missense probably damaging 1.00
R7114:Grb14 UTSW 2 64916853 missense probably damaging 1.00
R8290:Grb14 UTSW 2 64975585 missense probably benign 0.02
R8540:Grb14 UTSW 2 65021134 missense probably benign 0.14
X0021:Grb14 UTSW 2 64936425 missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- TGCCTACCTGTCTATGGCAC -3'
(R):5'- TTCAGGAGAGTGACACCAGC -3'

Sequencing Primer
(F):5'- TGTCTATGGCACCGCGGAG -3'
(R):5'- GCTGGCGCTCCATCCTC -3'
Posted On2018-02-19