Incidental Mutation 'R5775:Vmn2r-ps159'
ID502032
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R5775 (G1)
Quality Score24
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 156334397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCAGATATACATGACAAGGGCTAC -3'
(R):5'- GCAGTGATGTCCATTCCAAGGTG -3'

Sequencing Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- CCATTCCAAGGTGTTGTTGAATG -3'
Posted On2018-02-22