Incidental Mutation 'R6038:Nrm'
ID502040
Institutional Source Beutler Lab
Gene Symbol Nrm
Ensembl Gene ENSMUSG00000059791
Gene Namenurim (nuclear envelope membrane protein)
Synonyms2610307M02Rik
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R6038 (G1)
Quality Score73.0077
Status Validated
Chromosome17
Chromosomal Location35861318-35865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35861505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000133355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000082337] [ENSMUST00000122899] [ENSMUST00000127442] [ENSMUST00000144382] [ENSMUST00000174873]
Predicted Effect probably benign
Transcript: ENSMUST00000074259
AA Change: S41P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791
AA Change: S41P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122899
SMART Domains Protein: ENSMUSP00000120343
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127442
SMART Domains Protein: ENSMUSP00000115753
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 27 117 1.5e-39 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 540 6.9e-34 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144382
SMART Domains Protein: ENSMUSP00000116100
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect silent
Transcript: ENSMUST00000172931
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174873
AA Change: S41P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791
AA Change: S41P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Nrm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Nrm APN 17 35864755 missense probably benign 0.06
IGL02511:Nrm APN 17 35861424 missense probably damaging 1.00
R0211:Nrm UTSW 17 35864611 missense probably damaging 1.00
R0557:Nrm UTSW 17 35864632 missense probably damaging 1.00
R0602:Nrm UTSW 17 35864264 nonsense probably null
R0635:Nrm UTSW 17 35864264 nonsense probably null
R1571:Nrm UTSW 17 35864187 missense probably damaging 1.00
R2046:Nrm UTSW 17 35864217 missense probably benign 0.00
R4073:Nrm UTSW 17 35861532 splice site probably benign
R4612:Nrm UTSW 17 35863529 missense probably benign 0.00
R4828:Nrm UTSW 17 35864190 missense possibly damaging 0.72
R6322:Nrm UTSW 17 35864713 missense possibly damaging 0.73
R6456:Nrm UTSW 17 35865400 splice site probably null
R7345:Nrm UTSW 17 35864584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGACAGCGCTGAGATTC -3'
(R):5'- CAGCTTTCTGCACAAGACTAATC -3'

Sequencing Primer
(F):5'- GCTGAGATTCGACCCACAAGG -3'
(R):5'- AATCTTGGAGTTTCTGATTTAGCCTC -3'
Posted On2018-02-22