Incidental Mutation 'R6185:Fryl'
ID 502093
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock # R6185 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 73019987-73256619 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73112788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127] [ENSMUST00000153903]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: V367A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: V367A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: V367A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: V367A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153903
AA Change: V80A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119385
Gene: ENSMUSG00000070733
AA Change: V80A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 1 199 4.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153923
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Igf2 T A 7: 142,658,381 S4C possibly damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nrxn1 T A 17: 90,037,136 S57C probably damaging Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Sipa1l2 A T 8: 125,468,253 Y915* probably null Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Slc5a2 T C 7: 128,271,177 I529T probably damaging Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Spocd1 T C 4: 129,956,449 I756T probably benign Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense probably damaging 0.99
R8708:Fryl UTSW 5 73132562 missense probably benign 0.01
R8783:Fryl UTSW 5 73068842 missense probably benign 0.45
R9028:Fryl UTSW 5 73098266 missense probably benign 0.18
R9045:Fryl UTSW 5 73024775 missense
R9063:Fryl UTSW 5 73081003 missense possibly damaging 0.70
R9096:Fryl UTSW 5 73108577 missense probably benign 0.01
R9345:Fryl UTSW 5 73050411 missense probably benign
R9381:Fryl UTSW 5 73083294 missense probably benign 0.24
R9386:Fryl UTSW 5 73191809 missense unknown
R9401:Fryl UTSW 5 73065220 nonsense probably null
R9497:Fryl UTSW 5 73057791 missense
R9514:Fryl UTSW 5 73104772 missense probably damaging 1.00
R9570:Fryl UTSW 5 73022155 missense probably benign 0.02
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTAATTGCCACCCGGATG -3'
(R):5'- CTTCTTAGACTGAACAGAACAGGG -3'

Sequencing Primer
(F):5'- GGATGACTGTCACAGGCTTTTCC -3'
(R):5'- CTTAGACTGAACAGAACAGGGATGGG -3'
Posted On 2018-02-27