Incidental Mutation 'R6185:Sipa1l2'
ID502114
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6185 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 125468253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 915 (Y915*)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably null
Transcript: ENSMUST00000108775
AA Change: Y915*
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: Y915*

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212168
AA Change: Y915*
Predicted Effect probably null
Transcript: ENSMUST00000212987
AA Change: Y915*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fryl A G 5: 73,112,788 V367A probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Igf2 T A 7: 142,658,381 S4C possibly damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nrxn1 T A 17: 90,037,136 S57C probably damaging Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Slc5a2 T C 7: 128,271,177 I529T probably damaging Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Spocd1 T C 4: 129,956,449 I756T probably benign Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AAGCCCTGGGACTATAGTGG -3'
(R):5'- ATTCAGCTTCATCACGCTGGG -3'

Sequencing Primer
(F):5'- ATAGTGGAGTTCCCTGTACAACCTG -3'
(R):5'- TCAGCATCGGGGCCATCATG -3'
Posted On2018-02-27